Incidental Mutation 'R4736:Kif27'
ID359281
Institutional Source Beutler Lab
Gene Symbol Kif27
Ensembl Gene ENSMUSG00000060176
Gene Namekinesin family member 27
Synonyms4930517I18Rik
MMRRC Submission 041963-MU
Accession Numbers

NCBI RefSeq: NM_175214.3; MGI:1922300

Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R4736 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location58287502-58359122 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58328971 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 622 (T622A)
Ref Sequence ENSEMBL: ENSMUSP00000153598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043605] [ENSMUST00000224694] [ENSMUST00000225388]
Predicted Effect probably benign
Transcript: ENSMUST00000043605
AA Change: T622A

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000043304
Gene: ENSMUSG00000060176
AA Change: T622A

DomainStartEndE-ValueType
KISc 3 349 9.18e-160 SMART
low complexity region 369 385 N/A INTRINSIC
coiled coil region 386 418 N/A INTRINSIC
Blast:KISc 486 566 5e-29 BLAST
coiled coil region 710 790 N/A INTRINSIC
coiled coil region 835 891 N/A INTRINSIC
coiled coil region 916 972 N/A INTRINSIC
low complexity region 993 1008 N/A INTRINSIC
coiled coil region 1010 1078 N/A INTRINSIC
coiled coil region 1186 1226 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104240
Predicted Effect probably benign
Transcript: ENSMUST00000224694
Predicted Effect probably benign
Transcript: ENSMUST00000225388
AA Change: T622A

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype Strain: 4318693
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the KIF27 (kinesin 4) sub-family of the mammalian kinesin family. The gene is an ortholog of the Drosophila Cos2 gene, which plays an important role in the Hedgehog signaling pathway. The encoded protein contains an N-terminal motor domain which includes nucleotide-binding and microtubule-interacting regions, a stalk domain containing a predicted coiled coil motif and a C-terminal tail domain. Alternatively spliced transcript variants have been observed for this gene. Pseudogenes associated with this gene are located on chromosome 9. [provided by RefSeq, Dec 2012]
PHENOTYPE: Homozygous mice are small and die by 8 weeks and exhibit hydrocephalus, rhinitis and otitis media. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted(2) Gene trapped(7)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,068,485 I1145T probably damaging Het
Aadat T C 8: 60,540,106 V360A probably benign Het
Abhd16a A T 17: 35,101,883 T436S probably benign Het
Acbd5 G T 2: 23,099,584 L406F probably damaging Het
Agrn G A 4: 156,172,401 T1142M probably benign Het
Aig1 C A 10: 13,801,930 W106L probably damaging Het
Akr1d1 T C 6: 37,557,600 probably null Het
Ap1g1 G A 8: 109,855,082 D658N possibly damaging Het
Arhgap45 A G 10: 80,026,172 Y520C probably damaging Het
Arhgap5 A T 12: 52,519,077 M944L probably benign Het
Asic5 C T 3: 81,999,809 T47I possibly damaging Het
BC052040 A G 2: 115,581,888 I2V probably benign Het
Cabp5 A G 7: 13,400,739 probably null Het
Ccr6 A T 17: 8,256,064 R34* probably null Het
Clec4a2 T C 6: 123,140,663 I180T probably damaging Het
Cmtr1 A G 17: 29,700,242 E704G possibly damaging Het
Cyth3 G A 5: 143,684,479 probably null Het
Dbt T C 3: 116,539,132 I200T probably damaging Het
Dennd6b T C 15: 89,185,592 H468R probably benign Het
Depdc5 A G 5: 32,975,322 M1237V probably benign Het
Dpp6 A G 5: 27,712,659 Y616C probably damaging Het
Dync2h1 A T 9: 7,006,862 S3710T probably benign Het
Eif4g3 T A 4: 138,198,097 S1584T probably benign Het
Emc3 G A 6: 113,531,349 T45I possibly damaging Het
Esf1 T A 2: 140,124,971 D685V probably damaging Het
Ezr A G 17: 6,741,576 S366P probably benign Het
Gbe1 C T 16: 70,495,253 A491V probably damaging Het
Haus6 A G 4: 86,600,749 probably null Het
Heca G A 10: 17,915,187 Q12* probably null Het
Hpdl T C 4: 116,821,024 N80S probably damaging Het
Hydin A T 8: 110,523,208 Q2261L probably benign Het
Itgae G T 11: 73,114,880 R290L possibly damaging Het
Kcna10 C A 3: 107,195,492 L480I probably benign Het
Lama2 T C 10: 27,204,929 N966S probably damaging Het
Mdfic A G 6: 15,741,020 K38E possibly damaging Het
Med25 G A 7: 44,892,288 A26V probably damaging Het
Mrpl19 A T 6: 81,964,348 S77R probably damaging Het
Mybpc2 T C 7: 44,512,547 D493G probably damaging Het
Myh4 A G 11: 67,240,920 T69A probably benign Het
Myo16 G T 8: 10,373,527 G288W probably damaging Het
Myo9b T C 8: 71,356,592 L1815P probably damaging Het
Myom2 T A 8: 15,081,271 L323Q probably damaging Het
Naip1 T C 13: 100,444,526 D71G possibly damaging Het
Nktr T A 9: 121,749,739 probably benign Het
Nol10 A G 12: 17,355,287 K88E probably damaging Het
Nol4 T C 18: 22,718,993 D505G probably damaging Het
Nynrin T A 14: 55,863,997 N374K probably damaging Het
Obscn A T 11: 59,063,536 L3740Q probably damaging Het
Olfr1000 T C 2: 85,607,983 H309R probably benign Het
Otub2 T A 12: 103,392,844 L64Q probably benign Het
Pgm5 G A 19: 24,834,805 A121V probably damaging Het
Pi4ka A T 16: 17,377,175 Y120N probably benign Het
Rpl36al G A 12: 69,182,958 A60V possibly damaging Het
Rspo4 T C 2: 151,843,134 Y21H probably benign Het
Scube2 A G 7: 109,831,205 V455A probably benign Het
Serpina1f T C 12: 103,693,546 D159G probably damaging Het
Sf1 A G 19: 6,365,664 D11G probably damaging Het
Siglecg T C 7: 43,417,908 F633S probably benign Het
Skiv2l A G 17: 34,848,197 S89P possibly damaging Het
Slc22a13 T C 9: 119,193,632 E501G probably damaging Het
Slc44a3 A G 3: 121,510,206 S294P probably damaging Het
Smad3 T G 9: 63,757,560 K40Q probably damaging Het
Soga1 T A 2: 157,020,554 D1485V probably damaging Het
Stt3a T A 9: 36,749,712 M268L probably benign Het
Taf4 A T 2: 179,924,494 V817E probably damaging Het
Tgfbr1 A G 4: 47,383,835 T58A probably benign Het
Trpc6 T C 9: 8,609,870 V113A probably damaging Het
Ttll13 T A 7: 80,248,276 probably null Het
Uba7 T C 9: 107,980,165 L742P probably benign Het
Ulk2 A G 11: 61,833,435 L174P probably damaging Het
Unc5c A T 3: 141,816,931 Y706F probably benign Het
Unc80 A T 1: 66,649,672 probably null Het
Usp34 T A 11: 23,393,749 probably null Het
Vmn1r71 A T 7: 10,747,864 V233D possibly damaging Het
Xpo6 T C 7: 126,140,583 K439R probably benign Het
Xrn1 G T 9: 96,033,636 G1271C probably damaging Het
Yes1 A T 5: 32,660,777 E386V probably damaging Het
Zfp759 C A 13: 67,139,344 H320N probably damaging Het
Zfp990 A T 4: 145,536,942 H170L possibly damaging Het
Other mutations in Kif27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Kif27 APN 13 58337604 missense probably benign
IGL00421:Kif27 APN 13 58343889 missense probably damaging 1.00
IGL00903:Kif27 APN 13 58344672 missense possibly damaging 0.69
IGL01024:Kif27 APN 13 58288201 missense possibly damaging 0.71
IGL01070:Kif27 APN 13 58344093 missense probably damaging 1.00
IGL01761:Kif27 APN 13 58337645 missense probably benign
IGL02160:Kif27 APN 13 58325998 missense probably damaging 1.00
IGL03162:Kif27 APN 13 58311207 missense probably benign 0.03
P0016:Kif27 UTSW 13 58303452 nonsense probably null
R0016:Kif27 UTSW 13 58354714 missense probably damaging 1.00
R0016:Kif27 UTSW 13 58354714 missense probably damaging 1.00
R0018:Kif27 UTSW 13 58288053 missense probably benign
R0018:Kif27 UTSW 13 58288053 missense probably benign
R0049:Kif27 UTSW 13 58303564 missense probably damaging 1.00
R0049:Kif27 UTSW 13 58303564 missense probably damaging 1.00
R0481:Kif27 UTSW 13 58311264 splice site probably benign
R0960:Kif27 UTSW 13 58323967 missense probably damaging 0.99
R1015:Kif27 UTSW 13 58320215 missense probably damaging 1.00
R1205:Kif27 UTSW 13 58344205 missense probably benign 0.00
R1478:Kif27 UTSW 13 58303545 missense probably damaging 0.98
R1789:Kif27 UTSW 13 58344008 missense probably damaging 1.00
R1959:Kif27 UTSW 13 58293123 missense probably benign 0.00
R1961:Kif27 UTSW 13 58293123 missense probably benign 0.00
R3508:Kif27 UTSW 13 58313212 missense possibly damaging 0.88
R4168:Kif27 UTSW 13 58345748 missense probably benign 0.01
R4247:Kif27 UTSW 13 58287917 missense probably damaging 0.98
R4307:Kif27 UTSW 13 58344123 missense probably benign 0.00
R4621:Kif27 UTSW 13 58331013 missense probably benign 0.13
R4660:Kif27 UTSW 13 58323916 missense probably damaging 0.99
R4661:Kif27 UTSW 13 58323916 missense probably damaging 0.99
R4770:Kif27 UTSW 13 58344377 missense probably damaging 1.00
R4853:Kif27 UTSW 13 58311258 missense probably benign 0.06
R4963:Kif27 UTSW 13 58328994 missense possibly damaging 0.85
R4998:Kif27 UTSW 13 58293143 missense probably damaging 0.98
R5134:Kif27 UTSW 13 58291090 missense possibly damaging 0.80
R5225:Kif27 UTSW 13 58293101 missense possibly damaging 0.88
R5835:Kif27 UTSW 13 58313146 critical splice donor site probably null
R5875:Kif27 UTSW 13 58311104 missense probably benign 0.01
R5929:Kif27 UTSW 13 58343970 missense probably benign 0.01
R6175:Kif27 UTSW 13 58311237 missense probably damaging 1.00
R6446:Kif27 UTSW 13 58345716 missense probably damaging 1.00
R6628:Kif27 UTSW 13 58354797 missense probably damaging 1.00
Z1088:Kif27 UTSW 13 58288033 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGCAATGAAGAAACCACCAATT -3'
(R):5'- GGAACTGTATGGTACCAGAAAGA -3'

Sequencing Primer
(F):5'- TATAAGGATAATGCTTACCAAGAGCC -3'
(R):5'- CCTTCCAAGTGCTGGCATTAAAGG -3'
Posted On2015-11-11