Incidental Mutation 'R4736:Ezr'
ID359289
Institutional Source Beutler Lab
Gene Symbol Ezr
Ensembl Gene ENSMUSG00000052397
Gene Nameezrin
Synonymscytovillin, Vil2, ezrin, p81
MMRRC Submission 041963-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4736 (G1)
Quality Score175
Status Not validated
Chromosome17
Chromosomal Location6738041-6782784 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6741576 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 366 (S366P)
Ref Sequence ENSEMBL: ENSMUSP00000063734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064234] [ENSMUST00000097430] [ENSMUST00000159394] [ENSMUST00000159880] [ENSMUST00000160483] [ENSMUST00000161118] [ENSMUST00000162635]
Predicted Effect probably benign
Transcript: ENSMUST00000064234
AA Change: S366P

PolyPhen 2 Score 0.421 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000063734
Gene: ENSMUSG00000052397
AA Change: S366P

DomainStartEndE-ValueType
B41 1 206 7.74e-79 SMART
FERM_C 210 299 1.34e-35 SMART
Pfam:ERM 338 586 2.3e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097430
SMART Domains Protein: ENSMUSP00000095041
Gene: ENSMUSG00000041831

DomainStartEndE-ValueType
Pfam:FYVE_2 8 124 6e-25 PFAM
low complexity region 162 170 N/A INTRINSIC
C2 321 426 9.17e-15 SMART
C2 478 601 1.92e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131131
Predicted Effect probably benign
Transcript: ENSMUST00000159394
SMART Domains Protein: ENSMUSP00000124146
Gene: ENSMUSG00000041831

DomainStartEndE-ValueType
Pfam:FYVE_2 8 124 3.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159880
SMART Domains Protein: ENSMUSP00000125469
Gene: ENSMUSG00000041831

DomainStartEndE-ValueType
C2 116 221 9.17e-15 SMART
C2 273 396 1.92e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160483
SMART Domains Protein: ENSMUSP00000123996
Gene: ENSMUSG00000041831

DomainStartEndE-ValueType
C2 126 231 9.17e-15 SMART
C2 283 406 1.92e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161118
Predicted Effect probably benign
Transcript: ENSMUST00000162635
SMART Domains Protein: ENSMUSP00000124496
Gene: ENSMUSG00000041831

DomainStartEndE-ValueType
Pfam:FYVE_2 8 124 4.3e-27 PFAM
low complexity region 158 176 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232362
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The cytoplasmic peripheral membrane protein encoded by this gene functions as a protein-tyrosine kinase substrate in microvilli. As a member of the ERM protein family, this protein serves as an intermediate between the plasma membrane and the actin cytoskeleton. This protein plays a key role in cell surface structure adhesion, migration and organization, and it has been implicated in various human cancers. A pseudogene located on chromosome 3 has been identified for this gene. Alternatively spliced variants have also been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display postnatal lethality with abnormal intestinal villi morphology. Mice homozygous for a knock-down allele exhibit growth retardation, partial postnatal lethality, achlorhydria, and abnormal gastric parietal cell morphology and response to histamine stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,068,485 I1145T probably damaging Het
Aadat T C 8: 60,540,106 V360A probably benign Het
Abhd16a A T 17: 35,101,883 T436S probably benign Het
Acbd5 G T 2: 23,099,584 L406F probably damaging Het
Agrn G A 4: 156,172,401 T1142M probably benign Het
Aig1 C A 10: 13,801,930 W106L probably damaging Het
Akr1d1 T C 6: 37,557,600 probably null Het
Ap1g1 G A 8: 109,855,082 D658N possibly damaging Het
Arhgap45 A G 10: 80,026,172 Y520C probably damaging Het
Arhgap5 A T 12: 52,519,077 M944L probably benign Het
Asic5 C T 3: 81,999,809 T47I possibly damaging Het
BC052040 A G 2: 115,581,888 I2V probably benign Het
Cabp5 A G 7: 13,400,739 probably null Het
Ccr6 A T 17: 8,256,064 R34* probably null Het
Clec4a2 T C 6: 123,140,663 I180T probably damaging Het
Cmtr1 A G 17: 29,700,242 E704G possibly damaging Het
Cyth3 G A 5: 143,684,479 probably null Het
Dbt T C 3: 116,539,132 I200T probably damaging Het
Dennd6b T C 15: 89,185,592 H468R probably benign Het
Depdc5 A G 5: 32,975,322 M1237V probably benign Het
Dpp6 A G 5: 27,712,659 Y616C probably damaging Het
Dync2h1 A T 9: 7,006,862 S3710T probably benign Het
Eif4g3 T A 4: 138,198,097 S1584T probably benign Het
Emc3 G A 6: 113,531,349 T45I possibly damaging Het
Esf1 T A 2: 140,124,971 D685V probably damaging Het
Gbe1 C T 16: 70,495,253 A491V probably damaging Het
Haus6 A G 4: 86,600,749 probably null Het
Heca G A 10: 17,915,187 Q12* probably null Het
Hpdl T C 4: 116,821,024 N80S probably damaging Het
Hydin A T 8: 110,523,208 Q2261L probably benign Het
Itgae G T 11: 73,114,880 R290L possibly damaging Het
Kcna10 C A 3: 107,195,492 L480I probably benign Het
Kif27 T C 13: 58,328,971 T622A probably benign Het
Lama2 T C 10: 27,204,929 N966S probably damaging Het
Mdfic A G 6: 15,741,020 K38E possibly damaging Het
Med25 G A 7: 44,892,288 A26V probably damaging Het
Mrpl19 A T 6: 81,964,348 S77R probably damaging Het
Mybpc2 T C 7: 44,512,547 D493G probably damaging Het
Myh4 A G 11: 67,240,920 T69A probably benign Het
Myo16 G T 8: 10,373,527 G288W probably damaging Het
Myo9b T C 8: 71,356,592 L1815P probably damaging Het
Myom2 T A 8: 15,081,271 L323Q probably damaging Het
Naip1 T C 13: 100,444,526 D71G possibly damaging Het
Nktr T A 9: 121,749,739 probably benign Het
Nol10 A G 12: 17,355,287 K88E probably damaging Het
Nol4 T C 18: 22,718,993 D505G probably damaging Het
Nynrin T A 14: 55,863,997 N374K probably damaging Het
Obscn A T 11: 59,063,536 L3740Q probably damaging Het
Olfr1000 T C 2: 85,607,983 H309R probably benign Het
Otub2 T A 12: 103,392,844 L64Q probably benign Het
Pgm5 G A 19: 24,834,805 A121V probably damaging Het
Pi4ka A T 16: 17,377,175 Y120N probably benign Het
Rpl36al G A 12: 69,182,958 A60V possibly damaging Het
Rspo4 T C 2: 151,843,134 Y21H probably benign Het
Scube2 A G 7: 109,831,205 V455A probably benign Het
Serpina1f T C 12: 103,693,546 D159G probably damaging Het
Sf1 A G 19: 6,365,664 D11G probably damaging Het
Siglecg T C 7: 43,417,908 F633S probably benign Het
Skiv2l A G 17: 34,848,197 S89P possibly damaging Het
Slc22a13 T C 9: 119,193,632 E501G probably damaging Het
Slc44a3 A G 3: 121,510,206 S294P probably damaging Het
Smad3 T G 9: 63,757,560 K40Q probably damaging Het
Soga1 T A 2: 157,020,554 D1485V probably damaging Het
Stt3a T A 9: 36,749,712 M268L probably benign Het
Taf4 A T 2: 179,924,494 V817E probably damaging Het
Tgfbr1 A G 4: 47,383,835 T58A probably benign Het
Trpc6 T C 9: 8,609,870 V113A probably damaging Het
Ttll13 T A 7: 80,248,276 probably null Het
Uba7 T C 9: 107,980,165 L742P probably benign Het
Ulk2 A G 11: 61,833,435 L174P probably damaging Het
Unc5c A T 3: 141,816,931 Y706F probably benign Het
Unc80 A T 1: 66,649,672 probably null Het
Usp34 T A 11: 23,393,749 probably null Het
Vmn1r71 A T 7: 10,747,864 V233D possibly damaging Het
Xpo6 T C 7: 126,140,583 K439R probably benign Het
Xrn1 G T 9: 96,033,636 G1271C probably damaging Het
Yes1 A T 5: 32,660,777 E386V probably damaging Het
Zfp759 C A 13: 67,139,344 H320N probably damaging Het
Zfp990 A T 4: 145,536,942 H170L possibly damaging Het
Other mutations in Ezr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01783:Ezr APN 17 6742489 unclassified probably benign
IGL02871:Ezr APN 17 6742390 nonsense probably null
R0020:Ezr UTSW 17 6742727 missense probably damaging 1.00
R0020:Ezr UTSW 17 6742727 missense probably damaging 1.00
R0277:Ezr UTSW 17 6754765 nonsense probably null
R0323:Ezr UTSW 17 6754765 nonsense probably null
R0930:Ezr UTSW 17 6753999 nonsense probably null
R1497:Ezr UTSW 17 6742708 missense probably benign 0.07
R1669:Ezr UTSW 17 6739313 missense probably damaging 1.00
R1801:Ezr UTSW 17 6742372 missense possibly damaging 0.62
R2078:Ezr UTSW 17 6782642 start codon destroyed probably null 0.23
R4250:Ezr UTSW 17 6754797 missense probably damaging 1.00
R4448:Ezr UTSW 17 6753074 missense probably benign 0.01
R4610:Ezr UTSW 17 6739722 missense possibly damaging 0.71
R4691:Ezr UTSW 17 6759562 missense probably benign
R5327:Ezr UTSW 17 6753049 missense probably damaging 1.00
R6564:Ezr UTSW 17 6742847 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCAGCCCTCTCTATAATTCAGC -3'
(R):5'- GGCCACACTGAGGAAATGATC -3'

Sequencing Primer
(F):5'- TTCAGCATCTTGAAACCCAGG -3'
(R):5'- TGATCTTAGCAGAAATGAGCCCCG -3'
Posted On2015-11-11