Incidental Mutation 'R4736:Nol4'
ID359294
Institutional Source Beutler Lab
Gene Symbol Nol4
Ensembl Gene ENSMUSG00000041923
Gene Namenucleolar protein 4
Synonyms4930568N03Rik, 1700013J13Rik, LOC383304
MMRRC Submission 041963-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.544) question?
Stock #R4736 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location22693181-23041653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22718993 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 505 (D505G)
Ref Sequence ENSEMBL: ENSMUSP00000127870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081423] [ENSMUST00000097651] [ENSMUST00000164186] [ENSMUST00000164893]
Predicted Effect probably benign
Transcript: ENSMUST00000069215
AA Change: D350G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000064166
Gene: ENSMUSG00000041923
AA Change: D350G

DomainStartEndE-ValueType
low complexity region 54 65 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 342 361 N/A INTRINSIC
low complexity region 368 378 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081423
AA Change: D496G

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000080150
Gene: ENSMUSG00000041923
AA Change: D496G

DomainStartEndE-ValueType
low complexity region 139 155 N/A INTRINSIC
low complexity region 199 210 N/A INTRINSIC
low complexity region 309 320 N/A INTRINSIC
low complexity region 487 506 N/A INTRINSIC
low complexity region 513 523 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092015
AA Change: D286G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000089642
Gene: ENSMUSG00000041923
AA Change: D286G

DomainStartEndE-ValueType
low complexity region 54 65 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 278 297 N/A INTRINSIC
low complexity region 304 314 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097651
SMART Domains Protein: ENSMUSP00000095256
Gene: ENSMUSG00000041923

DomainStartEndE-ValueType
low complexity region 212 228 N/A INTRINSIC
low complexity region 272 283 N/A INTRINSIC
low complexity region 382 393 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164186
AA Change: D569G

PolyPhen 2 Score 0.275 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000130950
Gene: ENSMUSG00000041923
AA Change: D569G

DomainStartEndE-ValueType
low complexity region 212 228 N/A INTRINSIC
low complexity region 272 283 N/A INTRINSIC
low complexity region 382 393 N/A INTRINSIC
low complexity region 560 579 N/A INTRINSIC
low complexity region 586 596 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164893
AA Change: D505G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127870
Gene: ENSMUSG00000041923
AA Change: D505G

DomainStartEndE-ValueType
low complexity region 212 228 N/A INTRINSIC
low complexity region 272 283 N/A INTRINSIC
low complexity region 382 393 N/A INTRINSIC
low complexity region 496 515 N/A INTRINSIC
low complexity region 522 532 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,068,485 I1145T probably damaging Het
Aadat T C 8: 60,540,106 V360A probably benign Het
Abhd16a A T 17: 35,101,883 T436S probably benign Het
Acbd5 G T 2: 23,099,584 L406F probably damaging Het
Agrn G A 4: 156,172,401 T1142M probably benign Het
Aig1 C A 10: 13,801,930 W106L probably damaging Het
Akr1d1 T C 6: 37,557,600 probably null Het
Ap1g1 G A 8: 109,855,082 D658N possibly damaging Het
Arhgap45 A G 10: 80,026,172 Y520C probably damaging Het
Arhgap5 A T 12: 52,519,077 M944L probably benign Het
Asic5 C T 3: 81,999,809 T47I possibly damaging Het
BC052040 A G 2: 115,581,888 I2V probably benign Het
Cabp5 A G 7: 13,400,739 probably null Het
Ccr6 A T 17: 8,256,064 R34* probably null Het
Clec4a2 T C 6: 123,140,663 I180T probably damaging Het
Cmtr1 A G 17: 29,700,242 E704G possibly damaging Het
Cyth3 G A 5: 143,684,479 probably null Het
Dbt T C 3: 116,539,132 I200T probably damaging Het
Dennd6b T C 15: 89,185,592 H468R probably benign Het
Depdc5 A G 5: 32,975,322 M1237V probably benign Het
Dpp6 A G 5: 27,712,659 Y616C probably damaging Het
Dync2h1 A T 9: 7,006,862 S3710T probably benign Het
Eif4g3 T A 4: 138,198,097 S1584T probably benign Het
Emc3 G A 6: 113,531,349 T45I possibly damaging Het
Esf1 T A 2: 140,124,971 D685V probably damaging Het
Ezr A G 17: 6,741,576 S366P probably benign Het
Gbe1 C T 16: 70,495,253 A491V probably damaging Het
Haus6 A G 4: 86,600,749 probably null Het
Heca G A 10: 17,915,187 Q12* probably null Het
Hpdl T C 4: 116,821,024 N80S probably damaging Het
Hydin A T 8: 110,523,208 Q2261L probably benign Het
Itgae G T 11: 73,114,880 R290L possibly damaging Het
Kcna10 C A 3: 107,195,492 L480I probably benign Het
Kif27 T C 13: 58,328,971 T622A probably benign Het
Lama2 T C 10: 27,204,929 N966S probably damaging Het
Mdfic A G 6: 15,741,020 K38E possibly damaging Het
Med25 G A 7: 44,892,288 A26V probably damaging Het
Mrpl19 A T 6: 81,964,348 S77R probably damaging Het
Mybpc2 T C 7: 44,512,547 D493G probably damaging Het
Myh4 A G 11: 67,240,920 T69A probably benign Het
Myo16 G T 8: 10,373,527 G288W probably damaging Het
Myo9b T C 8: 71,356,592 L1815P probably damaging Het
Myom2 T A 8: 15,081,271 L323Q probably damaging Het
Naip1 T C 13: 100,444,526 D71G possibly damaging Het
Nktr T A 9: 121,749,739 probably benign Het
Nol10 A G 12: 17,355,287 K88E probably damaging Het
Nynrin T A 14: 55,863,997 N374K probably damaging Het
Obscn A T 11: 59,063,536 L3740Q probably damaging Het
Olfr1000 T C 2: 85,607,983 H309R probably benign Het
Otub2 T A 12: 103,392,844 L64Q probably benign Het
Pgm5 G A 19: 24,834,805 A121V probably damaging Het
Pi4ka A T 16: 17,377,175 Y120N probably benign Het
Rpl36al G A 12: 69,182,958 A60V possibly damaging Het
Rspo4 T C 2: 151,843,134 Y21H probably benign Het
Scube2 A G 7: 109,831,205 V455A probably benign Het
Serpina1f T C 12: 103,693,546 D159G probably damaging Het
Sf1 A G 19: 6,365,664 D11G probably damaging Het
Siglecg T C 7: 43,417,908 F633S probably benign Het
Skiv2l A G 17: 34,848,197 S89P possibly damaging Het
Slc22a13 T C 9: 119,193,632 E501G probably damaging Het
Slc44a3 A G 3: 121,510,206 S294P probably damaging Het
Smad3 T G 9: 63,757,560 K40Q probably damaging Het
Soga1 T A 2: 157,020,554 D1485V probably damaging Het
Stt3a T A 9: 36,749,712 M268L probably benign Het
Taf4 A T 2: 179,924,494 V817E probably damaging Het
Tgfbr1 A G 4: 47,383,835 T58A probably benign Het
Trpc6 T C 9: 8,609,870 V113A probably damaging Het
Ttll13 T A 7: 80,248,276 probably null Het
Uba7 T C 9: 107,980,165 L742P probably benign Het
Ulk2 A G 11: 61,833,435 L174P probably damaging Het
Unc5c A T 3: 141,816,931 Y706F probably benign Het
Unc80 A T 1: 66,649,672 probably null Het
Usp34 T A 11: 23,393,749 probably null Het
Vmn1r71 A T 7: 10,747,864 V233D possibly damaging Het
Xpo6 T C 7: 126,140,583 K439R probably benign Het
Xrn1 G T 9: 96,033,636 G1271C probably damaging Het
Yes1 A T 5: 32,660,777 E386V probably damaging Het
Zfp759 C A 13: 67,139,344 H320N probably damaging Het
Zfp990 A T 4: 145,536,942 H170L possibly damaging Het
Other mutations in Nol4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Nol4 APN 18 22823412 missense probably benign 0.15
IGL00677:Nol4 APN 18 22921867 missense probably damaging 1.00
IGL01153:Nol4 APN 18 22769793 missense probably damaging 1.00
IGL01400:Nol4 APN 18 22823498 missense probably damaging 0.99
IGL02006:Nol4 APN 18 22921918 missense probably damaging 1.00
IGL02342:Nol4 APN 18 22770869 splice site probably benign
IGL02501:Nol4 APN 18 22823341 missense probably damaging 1.00
PIT4378001:Nol4 UTSW 18 23039876 missense probably damaging 1.00
R0096:Nol4 UTSW 18 22921858 missense possibly damaging 0.95
R0097:Nol4 UTSW 18 22719141 missense probably benign 0.23
R0097:Nol4 UTSW 18 22719141 missense probably benign 0.23
R1257:Nol4 UTSW 18 22770681 missense probably damaging 1.00
R1793:Nol4 UTSW 18 22769821 missense probably damaging 1.00
R2101:Nol4 UTSW 18 22823409 missense probably damaging 1.00
R2357:Nol4 UTSW 18 23039910 missense probably benign 0.01
R2414:Nol4 UTSW 18 22823572 critical splice acceptor site probably null
R2427:Nol4 UTSW 18 22850698 intron probably benign
R3713:Nol4 UTSW 18 23039937 missense probably damaging 1.00
R3734:Nol4 UTSW 18 22770864 splice site probably benign
R3803:Nol4 UTSW 18 22694955 missense probably damaging 1.00
R4458:Nol4 UTSW 18 22751995 missense probably damaging 0.99
R4774:Nol4 UTSW 18 22912626 missense probably damaging 0.96
R4795:Nol4 UTSW 18 22921887 missense probably damaging 1.00
R5245:Nol4 UTSW 18 22695122 makesense probably null
R5980:Nol4 UTSW 18 22952201 missense probably damaging 0.97
R6372:Nol4 UTSW 18 23038556 critical splice donor site probably null
R6485:Nol4 UTSW 18 22770793 missense probably damaging 1.00
R6614:Nol4 UTSW 18 22920856 missense probably damaging 1.00
R6809:Nol4 UTSW 18 22920825 missense probably damaging 1.00
R6877:Nol4 UTSW 18 22719129 missense probably benign 0.06
R7269:Nol4 UTSW 18 23039789 missense probably benign
R7310:Nol4 UTSW 18 22770744 missense
Z1088:Nol4 UTSW 18 22921902 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATTGCATCATATTGCTGCTGC -3'
(R):5'- TGTTGCAGGATGAAGCTGC -3'

Sequencing Primer
(F):5'- TGGCAACAGAGTGAGCTACCC -3'
(R):5'- ATGAAGCTGCTCCTGCTGAC -3'
Posted On2015-11-11