Incidental Mutation 'R4737:Pappa2'
ID359304
Institutional Source Beutler Lab
Gene Symbol Pappa2
Ensembl Gene ENSMUSG00000073530
Gene Namepappalysin 2
Synonymspregnancy-associated plasma preproprotein-A2, placenta-specific 3, pregnancy-associated plasma protein-E, PAPP-A2, PLAC3, Pappe
MMRRC Submission 042024-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4737 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location158711727-158980490 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 158957012 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 143 (R143G)
Ref Sequence ENSEMBL: ENSMUSP00000124022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159861]
Predicted Effect probably benign
Transcript: ENSMUST00000159861
AA Change: R143G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124022
Gene: ENSMUSG00000073530
AA Change: R143G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Laminin_G_3 271 440 1.2e-25 PFAM
NL 572 614 2.81e-5 SMART
Pfam:Peptidase_M43 669 832 1.5e-12 PFAM
Blast:FN3 844 1103 1e-169 BLAST
low complexity region 1130 1139 N/A INTRINSIC
low complexity region 1361 1370 N/A INTRINSIC
CCP 1394 1457 4.97e0 SMART
CCP 1462 1519 4.81e-1 SMART
CCP 1523 1588 2.58e-4 SMART
CCP 1593 1644 1.13e0 SMART
NL 1720 1757 2.66e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159892
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177789
Meta Mutation Damage Score 0.1012 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 100% (94/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the pappalysin family of metzincin metalloproteinases. The encoded protein cleaves insulin-like growth factor-binding protein 5 and is thought to be a local regulator of insulin-like growth factor (IGF) bioavailability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a null mutation are viable and fertile but display postnatal growth retardation that is more pronounced in females compared to males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430110L20Rik A G 1: 181,227,819 noncoding transcript Het
Acp2 A T 2: 91,210,723 R419W probably benign Het
Actr5 A G 2: 158,628,071 N207S probably damaging Het
Afap1 G A 5: 35,961,782 V254M probably benign Het
Arfgef1 A T 1: 10,189,611 M544K possibly damaging Het
Arhgap5 A T 12: 52,519,077 M944L probably benign Het
Bnip3l-ps G A 12: 18,216,772 noncoding transcript Het
Carf A G 1: 60,109,318 T58A probably benign Het
Carns1 A G 19: 4,170,928 probably benign Het
Ccp110 T A 7: 118,724,548 I670K possibly damaging Het
Cftr T A 6: 18,299,883 D1218E probably benign Het
Chrna9 A T 5: 65,967,871 T52S probably damaging Het
Chst9 T C 18: 15,452,777 Y243C probably damaging Het
Clk2 A T 3: 89,168,709 H62L probably benign Het
Cntnap2 A T 6: 45,060,317 R10W possibly damaging Het
Cpt1b C T 15: 89,421,406 D369N probably benign Het
Crhr2 G T 6: 55,091,305 H423Q probably damaging Het
D8Ertd738e T A 8: 84,249,521 I33F probably damaging Het
Dbt T C 3: 116,539,132 I200T probably damaging Het
Ddhd1 A T 14: 45,628,821 probably benign Het
Ddx27 A G 2: 167,029,299 I480V probably benign Het
Dpp9 A C 17: 56,198,970 probably null Het
Dpy19l3 A T 7: 35,703,501 M562K probably damaging Het
Dus3l T C 17: 56,767,868 L330P probably damaging Het
Efcab7 C T 4: 99,831,568 Q96* probably null Het
Egfr T C 11: 16,869,231 F254L probably damaging Het
Eml5 C T 12: 98,798,852 V1566M probably damaging Het
Entpd7 T A 19: 43,691,195 Y62* probably null Het
Erbb4 T C 1: 68,343,900 M313V probably damaging Het
Gm5528 A G 1: 72,004,552 noncoding transcript Het
H2-M9 G T 17: 36,640,739 Y281* probably null Het
Hmcn1 T G 1: 150,689,595 K2260N possibly damaging Het
Hnf4a A G 2: 163,564,219 I259V probably benign Het
Ick A G 9: 78,150,654 T162A probably damaging Het
Insm1 A T 2: 146,222,902 T213S probably benign Het
Iqca T C 1: 90,077,822 D488G probably damaging Het
Kdm5a T A 6: 120,406,015 probably benign Het
Kdm7a G C 6: 39,152,839 L468V possibly damaging Het
Lck G A 4: 129,555,984 T229I possibly damaging Het
Lig3 T C 11: 82,787,727 L265P probably damaging Het
Lipa T A 19: 34,501,634 K229* probably null Het
Lrrk1 C T 7: 66,306,873 S418N probably benign Het
Mark2 A G 19: 7,281,232 V126A probably damaging Het
Met T C 6: 17,491,541 C101R probably damaging Het
Mkln1 A T 6: 31,426,799 K85M probably damaging Het
Mst1 A G 9: 108,080,521 R15G probably benign Het
Muc6 T G 7: 141,640,159 probably benign Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Myo7b T C 18: 31,998,602 S514G probably damaging Het
Narfl A T 17: 25,781,309 H322L probably damaging Het
Nars T C 18: 64,516,427 E11G probably benign Het
Ogdh T A 11: 6,297,044 F23I probably benign Het
Olfr1121 T C 2: 87,372,321 I263T probably damaging Het
Olfr1186 C T 2: 88,526,225 S214F probably damaging Het
Olfr1238 C T 2: 89,406,486 V198I probably benign Het
Olfr1272 A G 2: 90,282,381 S65P probably damaging Het
Olfr584 C T 7: 103,085,914 A127V probably damaging Het
Olfr825 T A 10: 130,162,838 T163S probably benign Het
Olfr979 A T 9: 40,000,422 D268E probably damaging Het
Otub2 T A 12: 103,392,844 L64Q probably benign Het
Patl2 T A 2: 122,125,306 T250S probably damaging Het
Pcdhac2 C T 18: 37,145,899 T644I possibly damaging Het
Pi4kb C T 3: 95,004,338 T690I probably damaging Het
Pla2g4d T C 2: 120,266,790 Y776C probably benign Het
Plekhh2 C T 17: 84,563,959 S215L probably benign Het
Psmd2 T G 16: 20,659,815 probably benign Het
Ptpn21 T C 12: 98,708,844 E183G probably benign Het
Ptprg T A 14: 12,226,314 D527E probably damaging Het
Rhobtb1 T A 10: 69,279,497 probably null Het
Scel T A 14: 103,572,037 M271K possibly damaging Het
Senp3 A T 11: 69,678,829 C310* probably null Het
Slc25a3 T C 10: 91,122,188 T97A possibly damaging Het
Srsf11 A T 3: 158,026,732 Y82* probably null Het
Tbc1d8 G A 1: 39,402,878 T211I possibly damaging Het
Tbkbp1 T C 11: 97,148,648 E145G probably damaging Het
Tln1 T C 4: 43,540,588 N1471S probably benign Het
Tnn T G 1: 160,146,089 D236A probably damaging Het
Trmt2a C T 16: 18,251,286 probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubxn10 G A 4: 138,735,948 probably benign Het
Ulk4 G A 9: 121,073,872 Q1180* probably null Het
Usp43 T A 11: 67,855,505 K1120N probably damaging Het
Uspl1 T A 5: 149,194,339 L244Q possibly damaging Het
Vmn1r32 T C 6: 66,553,645 H49R probably damaging Het
Vmn2r4 T C 3: 64,409,963 D118G probably damaging Het
Vwce A G 19: 10,650,579 I468V probably benign Het
Zbtb7c G T 18: 76,146,154 R561L probably benign Het
Zfp956 T C 6: 47,962,542 S175P probably damaging Het
Other mutations in Pappa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Pappa2 APN 1 158857148 missense probably damaging 1.00
IGL01394:Pappa2 APN 1 158765104 splice site probably benign
IGL01570:Pappa2 APN 1 158814540 nonsense probably null
IGL01618:Pappa2 APN 1 158857378 missense probably damaging 1.00
IGL01717:Pappa2 APN 1 158857132 critical splice donor site probably null
IGL01804:Pappa2 APN 1 158936519 missense probably benign
IGL01904:Pappa2 APN 1 158783941 missense probably damaging 0.99
IGL02116:Pappa2 APN 1 158845125 missense probably benign 0.01
IGL02174:Pappa2 APN 1 158761618 missense probably damaging 1.00
IGL02302:Pappa2 APN 1 158715001 missense probably benign 0.38
IGL02422:Pappa2 APN 1 158936933 missense probably damaging 1.00
IGL02572:Pappa2 APN 1 158851216 missense probably benign
IGL02659:Pappa2 APN 1 158936794 missense probably damaging 0.97
IGL02887:Pappa2 APN 1 158782259 missense probably damaging 1.00
IGL02981:Pappa2 APN 1 158851144 missense probably benign 0.00
IGL03128:Pappa2 APN 1 158936484 missense probably benign 0.16
IGL03142:Pappa2 APN 1 158854931 missense probably damaging 1.00
IGL03270:Pappa2 APN 1 158765067 missense possibly damaging 0.78
Gulliver UTSW 1 158857136 missense probably null 1.00
Lilliputian UTSW 1 158716990 missense probably damaging 1.00
Lilliputian2 UTSW 1 158834918 nonsense probably null
lilliputian3 UTSW 1 158782403 splice site probably null
Pitzel UTSW 1 158956645 missense probably damaging 1.00
R0106:Pappa2 UTSW 1 158714977 missense probably damaging 1.00
R0106:Pappa2 UTSW 1 158714977 missense probably damaging 1.00
R0172:Pappa2 UTSW 1 158854849 critical splice donor site probably null
R0194:Pappa2 UTSW 1 158765101 splice site probably benign
R0418:Pappa2 UTSW 1 158716990 missense probably damaging 1.00
R0421:Pappa2 UTSW 1 158848080 missense probably damaging 1.00
R0441:Pappa2 UTSW 1 158763058 unclassified probably benign
R0602:Pappa2 UTSW 1 158763055 unclassified probably benign
R0630:Pappa2 UTSW 1 158832773 missense probably benign
R0760:Pappa2 UTSW 1 158716961 critical splice donor site probably null
R1146:Pappa2 UTSW 1 158854982 missense probably damaging 1.00
R1146:Pappa2 UTSW 1 158854982 missense probably damaging 1.00
R1243:Pappa2 UTSW 1 158845100 missense probably damaging 1.00
R1413:Pappa2 UTSW 1 158936554 missense probably benign 0.00
R1502:Pappa2 UTSW 1 158957288 missense probably damaging 1.00
R1599:Pappa2 UTSW 1 158857172 missense probably damaging 1.00
R1689:Pappa2 UTSW 1 158957398 missense probably damaging 1.00
R1750:Pappa2 UTSW 1 158763150 nonsense probably null
R1772:Pappa2 UTSW 1 158814368 missense possibly damaging 0.92
R1832:Pappa2 UTSW 1 158857316 missense probably damaging 1.00
R1905:Pappa2 UTSW 1 158803503 splice site probably null
R1914:Pappa2 UTSW 1 158750563 missense probably damaging 0.97
R2013:Pappa2 UTSW 1 158834928 missense probably damaging 1.00
R2037:Pappa2 UTSW 1 158956644 nonsense probably null
R2118:Pappa2 UTSW 1 158857266 missense probably damaging 1.00
R2268:Pappa2 UTSW 1 158857271 missense probably damaging 1.00
R2269:Pappa2 UTSW 1 158857271 missense probably damaging 1.00
R2347:Pappa2 UTSW 1 158765043 missense probably damaging 1.00
R3024:Pappa2 UTSW 1 158936225 missense probably benign 0.00
R3706:Pappa2 UTSW 1 158834918 nonsense probably null
R3707:Pappa2 UTSW 1 158834918 nonsense probably null
R3708:Pappa2 UTSW 1 158834918 nonsense probably null
R4600:Pappa2 UTSW 1 158814445 missense probably damaging 1.00
R4738:Pappa2 UTSW 1 158957012 missense probably benign
R4739:Pappa2 UTSW 1 158957002 missense probably damaging 0.99
R4739:Pappa2 UTSW 1 158957012 missense probably benign
R4788:Pappa2 UTSW 1 158783917 missense possibly damaging 0.86
R4798:Pappa2 UTSW 1 158857379 missense probably damaging 0.99
R4952:Pappa2 UTSW 1 158857136 missense probably null 1.00
R5121:Pappa2 UTSW 1 158838627 missense probably benign 0.01
R5144:Pappa2 UTSW 1 158957133 missense probably benign 0.03
R5159:Pappa2 UTSW 1 158761619 missense probably damaging 1.00
R5278:Pappa2 UTSW 1 158782403 splice site probably null
R5428:Pappa2 UTSW 1 158814785 missense possibly damaging 0.53
R5452:Pappa2 UTSW 1 158838602 missense probably benign 0.00
R5477:Pappa2 UTSW 1 158956738 missense probably benign 0.00
R5504:Pappa2 UTSW 1 158848045 missense probably benign 0.00
R5852:Pappa2 UTSW 1 158717014 missense probably damaging 1.00
R6003:Pappa2 UTSW 1 158936250 missense probably benign 0.23
R6129:Pappa2 UTSW 1 158714997 nonsense probably null
R6137:Pappa2 UTSW 1 158871543 missense probably damaging 1.00
R6374:Pappa2 UTSW 1 158956645 missense probably damaging 1.00
R6472:Pappa2 UTSW 1 158834799 missense probably damaging 1.00
R6804:Pappa2 UTSW 1 158936868 missense probably benign 0.24
X0058:Pappa2 UTSW 1 158814397 missense probably null
X0061:Pappa2 UTSW 1 158936618 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- CTGGAAACCTTGAGGGGTATTC -3'
(R):5'- GCAGCAAACCCTGTATGCAG -3'

Sequencing Primer
(F):5'- GGGGTCTCCAGTCATGTCTTC -3'
(R):5'- CCCTGTATGCAGAATGGAGTC -3'
Posted On2015-11-11