Incidental Mutation 'R4737:Tln1'
ID359324
Institutional Source Beutler Lab
Gene Symbol Tln1
Ensembl Gene ENSMUSG00000028465
Gene Nametalin 1
Synonyms
MMRRC Submission 042024-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4737 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location43531519-43562691 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43540588 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 1471 (N1471S)
Ref Sequence ENSEMBL: ENSMUSP00000030187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030187]
PDB Structure
Crystal Structure of Talin Rod 482-655 [X-RAY DIFFRACTION]
Crystal Structure of talin residues 482-789 [X-RAY DIFFRACTION]
Vinculin complexed with the VBS1 helix from talin [X-RAY DIFFRACTION]
Solution structure of VBS2 fragment of talin [SOLUTION NMR]
[]
Structural basis for phosphatidylinositol phosphate kinase type I-gamma binding to talin at focal adhesions [X-RAY DIFFRACTION]
Vinculin Head (0-258) in Complex with the Talin Rod residues 1630-1652 [X-RAY DIFFRACTION]
Solution structure of VBS3 fragment of talin [SOLUTION NMR]
NMR structure of talin-PTB in complex with PIPKI [SOLUTION NMR]
NMR structure of the talin C-terminal actin binding site [SOLUTION NMR]
>> 17 additional structures at PDB <<
Predicted Effect probably benign
Transcript: ENSMUST00000030187
AA Change: N1471S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000030187
Gene: ENSMUSG00000028465
AA Change: N1471S

DomainStartEndE-ValueType
Blast:B41 2 76 5e-31 BLAST
B41 82 313 4.66e-73 SMART
IRS 308 401 7.65e-16 SMART
Pfam:Talin_middle 491 652 8.2e-60 PFAM
low complexity region 671 690 N/A INTRINSIC
internal_repeat_2 699 760 8.94e-6 PROSPERO
low complexity region 766 775 N/A INTRINSIC
PDB:1ZVZ|B 820 844 2e-7 PDB
low complexity region 866 879 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
PDB:2LQG|A 913 1044 2e-44 PDB
PDB:2L7N|A 1046 1207 1e-101 PDB
Pfam:VBS 1234 1358 9.6e-8 PFAM
internal_repeat_2 1488 1549 8.94e-6 PROSPERO
internal_repeat_3 1623 1769 4.92e-5 PROSPERO
low complexity region 1817 1828 N/A INTRINSIC
Pfam:VBS 1849 1973 6.2e-67 PFAM
PDB:3DYJ|B 1974 2293 N/A PDB
low complexity region 2305 2327 N/A INTRINSIC
ILWEQ 2336 2533 2.93e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134623
SMART Domains Protein: ENSMUSP00000119956
Gene: ENSMUSG00000028465

DomainStartEndE-ValueType
PDB:1U89|A 2 106 9e-50 PDB
low complexity region 107 120 N/A INTRINSIC
Meta Mutation Damage Score 0.076 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 100% (94/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein that is concentrated in areas of cell-substratum and cell-cell contacts. The encoded protein plays a significant role in the assembly of actin filaments and in spreading and migration of various cell types, including fibroblasts and osteoclasts. It codistributes with integrins in the cell surface membrane in order to assist in the attachment of adherent cells to extracellular matrices and of lymphocytes to other cells. The N-terminus of this protein contains elements for localization to cell-extracellular matrix junctions. The C-terminus contains binding sites for proteins such as beta-1-integrin, actin, and vinculin. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for either one of two knock-out alleles display early developmental anomalies, reduced embryo size, and embryonic lethality due to impaired cell migration at the gastrulation stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430110L20Rik A G 1: 181,227,819 noncoding transcript Het
Acp2 A T 2: 91,210,723 R419W probably benign Het
Actr5 A G 2: 158,628,071 N207S probably damaging Het
Afap1 G A 5: 35,961,782 V254M probably benign Het
Arfgef1 A T 1: 10,189,611 M544K possibly damaging Het
Arhgap5 A T 12: 52,519,077 M944L probably benign Het
Bnip3l-ps G A 12: 18,216,772 noncoding transcript Het
Carf A G 1: 60,109,318 T58A probably benign Het
Carns1 A G 19: 4,170,928 probably benign Het
Ccp110 T A 7: 118,724,548 I670K possibly damaging Het
Cftr T A 6: 18,299,883 D1218E probably benign Het
Chrna9 A T 5: 65,967,871 T52S probably damaging Het
Chst9 T C 18: 15,452,777 Y243C probably damaging Het
Clk2 A T 3: 89,168,709 H62L probably benign Het
Cntnap2 A T 6: 45,060,317 R10W possibly damaging Het
Cpt1b C T 15: 89,421,406 D369N probably benign Het
Crhr2 G T 6: 55,091,305 H423Q probably damaging Het
D8Ertd738e T A 8: 84,249,521 I33F probably damaging Het
Dbt T C 3: 116,539,132 I200T probably damaging Het
Ddhd1 A T 14: 45,628,821 probably benign Het
Ddx27 A G 2: 167,029,299 I480V probably benign Het
Dpp9 A C 17: 56,198,970 probably null Het
Dpy19l3 A T 7: 35,703,501 M562K probably damaging Het
Dus3l T C 17: 56,767,868 L330P probably damaging Het
Efcab7 C T 4: 99,831,568 Q96* probably null Het
Egfr T C 11: 16,869,231 F254L probably damaging Het
Eml5 C T 12: 98,798,852 V1566M probably damaging Het
Entpd7 T A 19: 43,691,195 Y62* probably null Het
Erbb4 T C 1: 68,343,900 M313V probably damaging Het
Gm5528 A G 1: 72,004,552 noncoding transcript Het
H2-M9 G T 17: 36,640,739 Y281* probably null Het
Hmcn1 T G 1: 150,689,595 K2260N possibly damaging Het
Hnf4a A G 2: 163,564,219 I259V probably benign Het
Ick A G 9: 78,150,654 T162A probably damaging Het
Insm1 A T 2: 146,222,902 T213S probably benign Het
Iqca T C 1: 90,077,822 D488G probably damaging Het
Kdm5a T A 6: 120,406,015 probably benign Het
Kdm7a G C 6: 39,152,839 L468V possibly damaging Het
Lck G A 4: 129,555,984 T229I possibly damaging Het
Lig3 T C 11: 82,787,727 L265P probably damaging Het
Lipa T A 19: 34,501,634 K229* probably null Het
Lrrk1 C T 7: 66,306,873 S418N probably benign Het
Mark2 A G 19: 7,281,232 V126A probably damaging Het
Met T C 6: 17,491,541 C101R probably damaging Het
Mkln1 A T 6: 31,426,799 K85M probably damaging Het
Mst1 A G 9: 108,080,521 R15G probably benign Het
Muc6 T G 7: 141,640,159 probably benign Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Myo7b T C 18: 31,998,602 S514G probably damaging Het
Narfl A T 17: 25,781,309 H322L probably damaging Het
Nars T C 18: 64,516,427 E11G probably benign Het
Ogdh T A 11: 6,297,044 F23I probably benign Het
Olfr1121 T C 2: 87,372,321 I263T probably damaging Het
Olfr1186 C T 2: 88,526,225 S214F probably damaging Het
Olfr1238 C T 2: 89,406,486 V198I probably benign Het
Olfr1272 A G 2: 90,282,381 S65P probably damaging Het
Olfr584 C T 7: 103,085,914 A127V probably damaging Het
Olfr825 T A 10: 130,162,838 T163S probably benign Het
Olfr979 A T 9: 40,000,422 D268E probably damaging Het
Otub2 T A 12: 103,392,844 L64Q probably benign Het
Pappa2 T C 1: 158,957,012 R143G probably benign Het
Patl2 T A 2: 122,125,306 T250S probably damaging Het
Pcdhac2 C T 18: 37,145,899 T644I possibly damaging Het
Pi4kb C T 3: 95,004,338 T690I probably damaging Het
Pla2g4d T C 2: 120,266,790 Y776C probably benign Het
Plekhh2 C T 17: 84,563,959 S215L probably benign Het
Psmd2 T G 16: 20,659,815 probably benign Het
Ptpn21 T C 12: 98,708,844 E183G probably benign Het
Ptprg T A 14: 12,226,314 D527E probably damaging Het
Rhobtb1 T A 10: 69,279,497 probably null Het
Scel T A 14: 103,572,037 M271K possibly damaging Het
Senp3 A T 11: 69,678,829 C310* probably null Het
Slc25a3 T C 10: 91,122,188 T97A possibly damaging Het
Srsf11 A T 3: 158,026,732 Y82* probably null Het
Tbc1d8 G A 1: 39,402,878 T211I possibly damaging Het
Tbkbp1 T C 11: 97,148,648 E145G probably damaging Het
Tnn T G 1: 160,146,089 D236A probably damaging Het
Trmt2a C T 16: 18,251,286 probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubxn10 G A 4: 138,735,948 probably benign Het
Ulk4 G A 9: 121,073,872 Q1180* probably null Het
Usp43 T A 11: 67,855,505 K1120N probably damaging Het
Uspl1 T A 5: 149,194,339 L244Q possibly damaging Het
Vmn1r32 T C 6: 66,553,645 H49R probably damaging Het
Vmn2r4 T C 3: 64,409,963 D118G probably damaging Het
Vwce A G 19: 10,650,579 I468V probably benign Het
Zbtb7c G T 18: 76,146,154 R561L probably benign Het
Zfp956 T C 6: 47,962,542 S175P probably damaging Het
Other mutations in Tln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Tln1 APN 4 43542719 missense probably benign 0.22
IGL00987:Tln1 APN 4 43551297 unclassified probably benign
IGL01345:Tln1 APN 4 43536281 missense probably damaging 1.00
IGL01456:Tln1 APN 4 43543432 unclassified probably benign
IGL01715:Tln1 APN 4 43555890 missense probably damaging 1.00
IGL01750:Tln1 APN 4 43545435 missense probably damaging 1.00
IGL01933:Tln1 APN 4 43539508 missense probably benign
IGL01933:Tln1 APN 4 43555894 missense possibly damaging 0.52
IGL02119:Tln1 APN 4 43546760 missense probably damaging 0.99
IGL02148:Tln1 APN 4 43555388 missense probably damaging 1.00
IGL02153:Tln1 APN 4 43546857 missense possibly damaging 0.76
IGL02522:Tln1 APN 4 43540612 missense probably benign 0.07
IGL02691:Tln1 APN 4 43539544 missense probably benign 0.42
IGL02882:Tln1 APN 4 43539522 missense probably benign 0.45
IGL02892:Tln1 APN 4 43555679 missense probably damaging 1.00
IGL03061:Tln1 APN 4 43545694 missense probably damaging 1.00
IGL03102:Tln1 APN 4 43532861 missense possibly damaging 0.89
IGL03183:Tln1 APN 4 43539084 splice site probably benign
H8786:Tln1 UTSW 4 43544589 missense probably damaging 0.97
PIT4576001:Tln1 UTSW 4 43539998 missense probably damaging 1.00
PIT4696001:Tln1 UTSW 4 43542701 critical splice donor site probably null
R0206:Tln1 UTSW 4 43549151 missense probably damaging 1.00
R0208:Tln1 UTSW 4 43549151 missense probably damaging 1.00
R0454:Tln1 UTSW 4 43553504 missense probably benign
R0539:Tln1 UTSW 4 43543434 critical splice donor site probably null
R0548:Tln1 UTSW 4 43542709 missense possibly damaging 0.79
R0561:Tln1 UTSW 4 43550304 missense possibly damaging 0.94
R0606:Tln1 UTSW 4 43547756 missense probably benign 0.34
R0607:Tln1 UTSW 4 43553071 missense probably damaging 1.00
R0609:Tln1 UTSW 4 43544645 missense possibly damaging 0.63
R0847:Tln1 UTSW 4 43555333 missense probably damaging 1.00
R0993:Tln1 UTSW 4 43549825 missense probably benign 0.22
R1255:Tln1 UTSW 4 43538044 missense probably damaging 1.00
R1292:Tln1 UTSW 4 43534578 critical splice donor site probably null
R1752:Tln1 UTSW 4 43536311 missense probably damaging 1.00
R2169:Tln1 UTSW 4 43548005 missense probably damaging 1.00
R2172:Tln1 UTSW 4 43545721 missense probably benign
R2202:Tln1 UTSW 4 43553083 unclassified probably null
R2680:Tln1 UTSW 4 43539668 missense probably damaging 1.00
R3012:Tln1 UTSW 4 43542525 missense probably benign
R3714:Tln1 UTSW 4 43540597 missense probably damaging 1.00
R3735:Tln1 UTSW 4 43549370 missense probably damaging 0.97
R3794:Tln1 UTSW 4 43536295 missense probably damaging 1.00
R3825:Tln1 UTSW 4 43536413 splice site probably benign
R3983:Tln1 UTSW 4 43553030 missense probably damaging 1.00
R4061:Tln1 UTSW 4 43549177 missense probably damaging 1.00
R4249:Tln1 UTSW 4 43536104 missense probably damaging 1.00
R4287:Tln1 UTSW 4 43543509 missense probably benign 0.01
R4471:Tln1 UTSW 4 43551018 missense probably benign 0.03
R4562:Tln1 UTSW 4 43533598 missense probably damaging 1.00
R4654:Tln1 UTSW 4 43535954 missense probably null 1.00
R4936:Tln1 UTSW 4 43547522 missense possibly damaging 0.83
R5225:Tln1 UTSW 4 43539406 missense probably benign 0.06
R5288:Tln1 UTSW 4 43540661 missense probably benign 0.06
R5421:Tln1 UTSW 4 43533609 missense possibly damaging 0.80
R5445:Tln1 UTSW 4 43543905 missense probably benign 0.26
R5660:Tln1 UTSW 4 43547732 missense probably damaging 1.00
R5772:Tln1 UTSW 4 43545191 missense probably benign 0.13
R6012:Tln1 UTSW 4 43539508 missense probably benign
R6038:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6038:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6039:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6039:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6052:Tln1 UTSW 4 43555052 missense probably damaging 0.99
R6145:Tln1 UTSW 4 43538030 missense possibly damaging 0.64
R6157:Tln1 UTSW 4 43534744 missense probably benign 0.06
R6242:Tln1 UTSW 4 43533145 missense probably damaging 1.00
R6454:Tln1 UTSW 4 43533866 missense probably damaging 0.99
R6467:Tln1 UTSW 4 43543165 missense probably benign 0.42
R6548:Tln1 UTSW 4 43547525 missense probably damaging 0.98
R6576:Tln1 UTSW 4 43555419 splice site probably null
R6722:Tln1 UTSW 4 43547618 missense probably damaging 1.00
R6968:Tln1 UTSW 4 43550217 missense probably benign 0.02
R7000:Tln1 UTSW 4 43556302 missense probably damaging 0.96
R7137:Tln1 UTSW 4 43540616 missense probably damaging 1.00
R7242:Tln1 UTSW 4 43542602 missense probably benign 0.01
R7294:Tln1 UTSW 4 43534399 missense probably benign 0.02
R7312:Tln1 UTSW 4 43545922 missense probably damaging 1.00
X0052:Tln1 UTSW 4 43533125 critical splice donor site probably null
X0063:Tln1 UTSW 4 43548015 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGCCCTTGTGAAAGGTGGG -3'
(R):5'- TCTGAAATAGTTGGGTCAGTTTAAC -3'

Sequencing Primer
(F):5'- GGGGACGAATCTTGCCTTCTC -3'
(R):5'- AATAAGTTTGTTTTAAGCTGGGTGAC -3'
Posted On2015-11-11