Incidental Mutation 'R0332:Gpatch8'
ID35938
Institutional Source Beutler Lab
Gene Symbol Gpatch8
Ensembl Gene ENSMUSG00000034621
Gene NameG patch domain containing 8
SynonymsENSMUSG00000075516, Fbm1, 5430405G24Rik, Gpatc8
MMRRC Submission 038541-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.515) question?
Stock #R0332 (G1)
Quality Score196
Status Validated
Chromosome11
Chromosomal Location102475915-102556392 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102481842 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 290 (N290S)
Ref Sequence ENSEMBL: ENSMUSP00000120649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000143842]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000069673
Predicted Effect unknown
Transcript: ENSMUST00000143842
AA Change: N290S
SMART Domains Protein: ENSMUSP00000120649
Gene: ENSMUSG00000034621
AA Change: N290S

DomainStartEndE-ValueType
G_patch 38 84 6.03e-12 SMART
coiled coil region 89 130 N/A INTRINSIC
ZnF_C2H2 136 160 6.4e0 SMART
coiled coil region 183 209 N/A INTRINSIC
low complexity region 224 234 N/A INTRINSIC
low complexity region 235 246 N/A INTRINSIC
internal_repeat_1 307 391 1.55e-5 PROSPERO
low complexity region 474 490 N/A INTRINSIC
internal_repeat_1 583 658 1.55e-5 PROSPERO
low complexity region 666 687 N/A INTRINSIC
low complexity region 691 720 N/A INTRINSIC
low complexity region 722 753 N/A INTRINSIC
low complexity region 761 772 N/A INTRINSIC
low complexity region 798 820 N/A INTRINSIC
low complexity region 829 885 N/A INTRINSIC
low complexity region 887 980 N/A INTRINSIC
low complexity region 988 1010 N/A INTRINSIC
low complexity region 1166 1183 N/A INTRINSIC
low complexity region 1208 1217 N/A INTRINSIC
low complexity region 1326 1342 N/A INTRINSIC
low complexity region 1345 1361 N/A INTRINSIC
low complexity region 1379 1404 N/A INTRINSIC
low complexity region 1438 1452 N/A INTRINSIC
low complexity region 1463 1490 N/A INTRINSIC
Meta Mutation Damage Score 0.074 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains an RNA-processing domain, a zinc finger domain, a lysine-rich region and a serine-rich region. A mutation in the serine-rich region of the protein is thought to be associated with hyperuricemia (PMID: 21594610). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik A T 17: 23,714,604 probably benign Het
Aggf1 T C 13: 95,369,446 E211G probably damaging Het
Aox3 A G 1: 58,142,751 N299S probably benign Het
Arhgef7 T A 8: 11,824,701 Y777* probably null Het
Atad1 A G 19: 32,702,534 probably benign Het
Bop1 A G 15: 76,455,987 Y130H probably damaging Het
Ccar2 G T 14: 70,141,935 probably benign Het
Ccdc110 G T 8: 45,942,964 E631* probably null Het
Cfap54 C T 10: 93,035,457 D634N probably damaging Het
Cldn8 C T 16: 88,562,358 silent Het
Cstf3 G T 2: 104,646,467 probably null Het
Dgkq T C 5: 108,655,099 probably benign Het
Dsp T A 13: 38,182,228 L546* probably null Het
Eif3g A T 9: 20,897,984 probably benign Het
Fam228a T A 12: 4,735,018 I38F probably damaging Het
Fto A T 8: 91,401,890 probably benign Het
Gcnt4 G T 13: 96,946,510 V105L probably benign Het
Gm10644 A G 8: 83,933,581 L45S possibly damaging Het
Gm7275 A T 16: 48,073,769 noncoding transcript Het
Gm7579 T C 7: 142,212,375 S173P unknown Het
Hspb8 T A 5: 116,409,473 D150V probably damaging Het
Ifitm1 T C 7: 140,968,453 probably benign Het
Ifnl2 T C 7: 28,509,331 T99A possibly damaging Het
Ints4 T C 7: 97,517,718 L577P probably damaging Het
Jph4 T C 14: 55,114,010 E183G possibly damaging Het
Loxhd1 T A 18: 77,383,830 probably null Het
Mug1 G A 6: 121,849,897 probably null Het
Nlrp2 C A 7: 5,317,630 C836F probably damaging Het
Nup210l G T 3: 90,132,309 probably benign Het
Olfr18 A G 9: 20,314,056 L288S probably benign Het
Olfr555 A T 7: 102,659,465 I215F probably damaging Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Phykpl A G 11: 51,586,675 E98G probably benign Het
Pikfyve A G 1: 65,264,399 N1648D probably benign Het
Plppr5 A T 3: 117,671,932 R277S probably benign Het
Ppp1r36 T A 12: 76,427,903 F86L probably benign Het
Pqlc2 C T 4: 139,300,299 S244N possibly damaging Het
Ptgis A T 2: 167,214,833 L278Q probably damaging Het
Rasa2 A T 9: 96,606,176 F90Y probably damaging Het
Setd3 T C 12: 108,107,579 K480E probably benign Het
Snx2 T C 18: 53,212,911 F389L probably benign Het
Sulf2 G A 2: 166,089,199 T296M probably benign Het
Supt16 A T 14: 52,181,157 H214Q probably damaging Het
Tbx4 A T 11: 85,898,530 M12L probably benign Het
Tlk1 A T 2: 70,745,565 probably null Het
Tmprss7 C T 16: 45,680,638 V267M probably benign Het
Tmub2 G A 11: 102,288,348 R291H probably damaging Het
Trpm2 A T 10: 77,947,988 V217E probably damaging Het
Try10 T A 6: 41,354,220 V10E probably benign Het
Ttn A G 2: 76,765,882 V20229A probably benign Het
Ttn A C 2: 76,778,194 probably null Het
Uhrf1bp1 T C 17: 27,893,294 probably null Het
Usf2 T A 7: 30,955,179 M199L possibly damaging Het
Usp37 A T 1: 74,495,710 S26T possibly damaging Het
Vrk1 G C 12: 106,058,625 Q253H probably benign Het
Wdr72 A T 9: 74,157,252 probably null Het
Xrra1 T C 7: 99,876,242 F123L probably damaging Het
Zfhx3 T C 8: 108,946,623 I1435T probably damaging Het
Zfp712 T A 13: 67,040,813 H550L probably damaging Het
Other mutations in Gpatch8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Gpatch8 APN 11 102478878 missense probably damaging 1.00
IGL00590:Gpatch8 APN 11 102480549 missense unknown
IGL00835:Gpatch8 APN 11 102478549 missense probably damaging 1.00
IGL00971:Gpatch8 APN 11 102479917 missense unknown
IGL01395:Gpatch8 APN 11 102480708 missense unknown
IGL02386:Gpatch8 APN 11 102508157 missense unknown
IGL02476:Gpatch8 APN 11 102478591 missense probably damaging 1.00
IGL02809:Gpatch8 APN 11 102487590 missense unknown
IGL02985:Gpatch8 APN 11 102481510 missense unknown
IGL03013:Gpatch8 APN 11 102508197 missense unknown
R0464:Gpatch8 UTSW 11 102480886 missense unknown
R0710:Gpatch8 UTSW 11 102481933 missense unknown
R0734:Gpatch8 UTSW 11 102481400 missense unknown
R1458:Gpatch8 UTSW 11 102481229 missense unknown
R1919:Gpatch8 UTSW 11 102508142 critical splice donor site probably null
R2007:Gpatch8 UTSW 11 102500831 missense unknown
R2495:Gpatch8 UTSW 11 102478481 missense probably damaging 1.00
R2881:Gpatch8 UTSW 11 102479917 missense unknown
R2939:Gpatch8 UTSW 11 102508184 missense unknown
R4672:Gpatch8 UTSW 11 102478958 missense probably damaging 1.00
R4903:Gpatch8 UTSW 11 102480133 missense unknown
R4931:Gpatch8 UTSW 11 102481224 missense unknown
R5230:Gpatch8 UTSW 11 102479578 missense probably damaging 1.00
R5288:Gpatch8 UTSW 11 102508227 intron probably null
R5384:Gpatch8 UTSW 11 102508227 intron probably null
R5386:Gpatch8 UTSW 11 102508227 intron probably null
R5564:Gpatch8 UTSW 11 102538285 missense unknown
R5668:Gpatch8 UTSW 11 102500867 missense unknown
R5954:Gpatch8 UTSW 11 102480941 missense unknown
R5966:Gpatch8 UTSW 11 102480232 missense unknown
R6018:Gpatch8 UTSW 11 102480915 missense unknown
R6176:Gpatch8 UTSW 11 102487524 missense unknown
R6388:Gpatch8 UTSW 11 102478488 missense probably damaging 1.00
Z1088:Gpatch8 UTSW 11 102480945 missense unknown
Predicted Primers PCR Primer
(F):5'- TTACTACAGCCTTGCGGCTTGG -3'
(R):5'- CAACAGTGGTGCAAGTGCTGTTTC -3'

Sequencing Primer
(F):5'- AGATTACCAGTGCCATCAGTATCTC -3'
(R):5'- GCAAGTGCTGTTTCTTCTTGTG -3'
Posted On2013-05-09