Incidental Mutation 'R0332:Vrk1'
ID35941
Institutional Source Beutler Lab
Gene Symbol Vrk1
Ensembl Gene ENSMUSG00000021115
Gene Namevaccinia related kinase 1
Synonyms51PK
MMRRC Submission 038541-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.687) question?
Stock #R0332 (G1)
Quality Score222
Status Validated
Chromosome12
Chromosomal Location106010228-106077426 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 106058625 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 253 (Q253H)
Ref Sequence ENSEMBL: ENSMUSP00000152109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021539] [ENSMUST00000072040] [ENSMUST00000085026] [ENSMUST00000220629] [ENSMUST00000221312]
Predicted Effect probably benign
Transcript: ENSMUST00000021539
AA Change: Q253H

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000021539
Gene: ENSMUSG00000021115
AA Change: Q253H

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 37 222 4.5e-10 PFAM
Pfam:Pkinase 37 316 2.4e-16 PFAM
low complexity region 354 366 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072040
AA Change: Q253H

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000071922
Gene: ENSMUSG00000021115
AA Change: Q253H

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 37 296 8.9e-11 PFAM
Pfam:Pkinase 37 323 1.9e-19 PFAM
low complexity region 354 366 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085026
AA Change: Q253H

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000082101
Gene: ENSMUSG00000021115
AA Change: Q253H

DomainStartEndE-ValueType
Pfam:Pkinase 37 323 8e-19 PFAM
Pfam:Pkinase_Tyr 37 324 3.5e-10 PFAM
low complexity region 354 366 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220629
AA Change: Q253H

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000221312
AA Change: Q253H

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
Meta Mutation Damage Score 0.1328 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. This gene is widely expressed in human tissues and has increased expression in actively dividing cells, such as those in testis, thymus, fetal liver, and carcinomas. Its protein localizes to the nucleus and has been shown to promote the stability and nuclear accumulation of a transcriptionally active p53 molecule and, in vitro, to phosphorylate Thr18 of p53 and reduce p53 ubiquitination. This gene, therefore, may regulate cell proliferation. This protein also phosphorylates histone, casein, and the transcription factors ATF2 (activating transcription factor 2) and c-JUN. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a gene trap allele yielding nearly full-length protein levels are fertile and overtly normal. Homozygotes for a hypomorphic gene trap allele are sterile; male infertility is due to progressive loss of proliferating spermatogonia leading to lack of meiotic cells and mature sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik A T 17: 23,714,604 probably benign Het
Aggf1 T C 13: 95,369,446 E211G probably damaging Het
Aox3 A G 1: 58,142,751 N299S probably benign Het
Arhgef7 T A 8: 11,824,701 Y777* probably null Het
Atad1 A G 19: 32,702,534 probably benign Het
Bop1 A G 15: 76,455,987 Y130H probably damaging Het
Ccar2 G T 14: 70,141,935 probably benign Het
Ccdc110 G T 8: 45,942,964 E631* probably null Het
Cfap54 C T 10: 93,035,457 D634N probably damaging Het
Cldn8 C T 16: 88,562,358 silent Het
Cstf3 G T 2: 104,646,467 probably null Het
Dgkq T C 5: 108,655,099 probably benign Het
Dsp T A 13: 38,182,228 L546* probably null Het
Eif3g A T 9: 20,897,984 probably benign Het
Fam228a T A 12: 4,735,018 I38F probably damaging Het
Fto A T 8: 91,401,890 probably benign Het
Gcnt4 G T 13: 96,946,510 V105L probably benign Het
Gm10644 A G 8: 83,933,581 L45S possibly damaging Het
Gm7275 A T 16: 48,073,769 noncoding transcript Het
Gm7579 T C 7: 142,212,375 S173P unknown Het
Gpatch8 T C 11: 102,481,842 N290S unknown Het
Hspb8 T A 5: 116,409,473 D150V probably damaging Het
Ifitm1 T C 7: 140,968,453 probably benign Het
Ifnl2 T C 7: 28,509,331 T99A possibly damaging Het
Ints4 T C 7: 97,517,718 L577P probably damaging Het
Jph4 T C 14: 55,114,010 E183G possibly damaging Het
Loxhd1 T A 18: 77,383,830 probably null Het
Mug1 G A 6: 121,849,897 probably null Het
Nlrp2 C A 7: 5,317,630 C836F probably damaging Het
Nup210l G T 3: 90,132,309 probably benign Het
Olfr18 A G 9: 20,314,056 L288S probably benign Het
Olfr555 A T 7: 102,659,465 I215F probably damaging Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Phykpl A G 11: 51,586,675 E98G probably benign Het
Pikfyve A G 1: 65,264,399 N1648D probably benign Het
Plppr5 A T 3: 117,671,932 R277S probably benign Het
Ppp1r36 T A 12: 76,427,903 F86L probably benign Het
Pqlc2 C T 4: 139,300,299 S244N possibly damaging Het
Ptgis A T 2: 167,214,833 L278Q probably damaging Het
Rasa2 A T 9: 96,606,176 F90Y probably damaging Het
Setd3 T C 12: 108,107,579 K480E probably benign Het
Snx2 T C 18: 53,212,911 F389L probably benign Het
Sulf2 G A 2: 166,089,199 T296M probably benign Het
Supt16 A T 14: 52,181,157 H214Q probably damaging Het
Tbx4 A T 11: 85,898,530 M12L probably benign Het
Tlk1 A T 2: 70,745,565 probably null Het
Tmprss7 C T 16: 45,680,638 V267M probably benign Het
Tmub2 G A 11: 102,288,348 R291H probably damaging Het
Trpm2 A T 10: 77,947,988 V217E probably damaging Het
Try10 T A 6: 41,354,220 V10E probably benign Het
Ttn A G 2: 76,765,882 V20229A probably benign Het
Ttn A C 2: 76,778,194 probably null Het
Uhrf1bp1 T C 17: 27,893,294 probably null Het
Usf2 T A 7: 30,955,179 M199L possibly damaging Het
Usp37 A T 1: 74,495,710 S26T possibly damaging Het
Wdr72 A T 9: 74,157,252 probably null Het
Xrra1 T C 7: 99,876,242 F123L probably damaging Het
Zfhx3 T C 8: 108,946,623 I1435T probably damaging Het
Zfp712 T A 13: 67,040,813 H550L probably damaging Het
Other mutations in Vrk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Vrk1 APN 12 106058581 missense probably damaging 1.00
IGL00639:Vrk1 APN 12 106055916 splice site probably null
IGL02072:Vrk1 APN 12 106042885 missense probably benign 0.04
IGL02387:Vrk1 APN 12 106070544 missense probably damaging 1.00
IGL02479:Vrk1 APN 12 106051002 missense probably benign 0.00
IGL02501:Vrk1 APN 12 106062653 missense probably benign
IGL03211:Vrk1 APN 12 106036588 missense probably benign 0.03
R0790:Vrk1 UTSW 12 106070624 missense probably benign
R1897:Vrk1 UTSW 12 106036540 splice site probably benign
R1911:Vrk1 UTSW 12 106057977 critical splice donor site probably null
R2289:Vrk1 UTSW 12 106057861 missense probably damaging 1.00
R2981:Vrk1 UTSW 12 106051793 missense probably damaging 1.00
R4885:Vrk1 UTSW 12 106057972 missense probably damaging 1.00
R4905:Vrk1 UTSW 12 106051828 missense probably damaging 1.00
R5220:Vrk1 UTSW 12 106073606 splice site probably null
R5366:Vrk1 UTSW 12 106055819 missense possibly damaging 0.78
R5499:Vrk1 UTSW 12 106051765 missense possibly damaging 0.92
R6666:Vrk1 UTSW 12 106058651 missense probably damaging 1.00
R6907:Vrk1 UTSW 12 106075032 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GGTTTGTTTTACACAGCCCACTGTTCA -3'
(R):5'- AGAATCTGTGCCTCCCTCACCA -3'

Sequencing Primer
(F):5'- GTTCAGTGATTTTATTATACGCAGGC -3'
(R):5'- aaggagagggggagataagtag -3'
Posted On2013-05-09