Incidental Mutation 'R4739:Fsip2'
ID359487
Institutional Source Beutler Lab
Gene Symbol Fsip2
Ensembl Gene ENSMUSG00000075249
Gene Namefibrous sheath-interacting protein 2
SynonymsOTTMUSG00000013335
MMRRC Submission 042025-MU
Accession Numbers

Genbank: XM_913669; MGI: 2664111

Is this an essential gene? Possibly non essential (E-score: 0.271) question?
Stock #R4739 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location82943634-83008937 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 82975353 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 672 (D672A)
Ref Sequence ENSEMBL: ENSMUSP00000120314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000143764]
Predicted Effect possibly damaging
Transcript: ENSMUST00000143764
AA Change: D672A

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120314
Gene: ENSMUSG00000075249
AA Change: D672A

DomainStartEndE-ValueType
coiled coil region 271 297 N/A INTRINSIC
low complexity region 544 561 N/A INTRINSIC
low complexity region 586 597 N/A INTRINSIC
low complexity region 882 895 N/A INTRINSIC
low complexity region 925 939 N/A INTRINSIC
low complexity region 1115 1120 N/A INTRINSIC
low complexity region 1531 1545 N/A INTRINSIC
low complexity region 2044 2057 N/A INTRINSIC
low complexity region 2507 2523 N/A INTRINSIC
low complexity region 2564 2575 N/A INTRINSIC
low complexity region 2866 2877 N/A INTRINSIC
low complexity region 2896 2915 N/A INTRINSIC
low complexity region 3220 3231 N/A INTRINSIC
low complexity region 3438 3447 N/A INTRINSIC
Pfam:FSIP2 4045 4408 3.5e-42 PFAM
Pfam:FSIP2 4375 4613 7.7e-26 PFAM
Pfam:FSIP2 4622 4932 4.3e-17 PFAM
Pfam:FSIP2 4903 5454 7e-27 PFAM
low complexity region 5507 5522 N/A INTRINSIC
low complexity region 5769 5780 N/A INTRINSIC
low complexity region 5834 5846 N/A INTRINSIC
low complexity region 5851 5867 N/A INTRINSIC
Pfam:FSIP2 5998 6867 N/A PFAM
low complexity region 6977 6990 N/A INTRINSIC
Meta Mutation Damage Score 0.14 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 96% (102/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein associated with the sperm fibrous sheath. Genes encoding most of the fibrous-sheath associated proteins genes are transcribed only during the postmeiotic period of spermatogenesis. The protein encoded by this gene is specific to spermatogenic cells. Copy number variation in this gene may be associated with testicular germ cell tumors. Pseudogenes associated with this gene are reported on chromosomes 2 and X. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012P17Rik C T 1: 158,969,334 noncoding transcript Het
2300002M23Rik A G 17: 35,567,506 probably benign Het
Aadat T C 8: 60,540,106 V360A probably benign Het
Abcc5 T A 16: 20,399,626 D283V probably damaging Het
Abraxas1 T A 5: 100,812,020 K155N probably damaging Het
Acot3 T C 12: 84,058,590 I277T probably benign Het
Ankrd45 G A 1: 161,155,390 C157Y probably damaging Het
Apol10a C T 15: 77,488,641 T159I possibly damaging Het
Arhgef11 G A 3: 87,697,999 V214M possibly damaging Het
Ash1l A C 3: 88,982,845 N677T probably benign Het
Atg13 A G 2: 91,684,695 S254P probably damaging Het
Atg16l2 A G 7: 101,297,178 L129P probably damaging Het
Avl9 T A 6: 56,726,309 V120D probably damaging Het
Cc2d1b T C 4: 108,628,042 V527A probably benign Het
Ccnl1 A G 3: 65,946,671 probably benign Het
Cenpl T A 1: 161,083,267 D261E probably damaging Het
Cep192 T G 18: 67,851,732 I1604M probably benign Het
Cep95 A G 11: 106,815,734 I573V probably benign Het
Cfap100 A G 6: 90,412,843 probably null Het
Cmc1 T A 9: 118,075,177 M49L probably benign Het
Cyfip2 G T 11: 46,279,993 N176K probably damaging Het
Cyp2w1 T C 5: 139,356,675 F408L probably damaging Het
D630045J12Rik G A 6: 38,196,036 S399F possibly damaging Het
Dcbld2 T A 16: 58,460,976 L528Q probably damaging Het
Dip2b T C 15: 100,207,777 V1138A probably damaging Het
Dip2c T A 13: 9,533,339 L119Q probably damaging Het
Dnah3 T C 7: 120,077,946 D444G possibly damaging Het
Dsg1c A T 18: 20,275,189 N432Y possibly damaging Het
Dst T A 1: 34,191,147 I2785N probably benign Het
Dynap A T 18: 70,241,225 Y77N possibly damaging Het
Eif4g3 T C 4: 138,183,199 L1330P possibly damaging Het
Eif4g3 T A 4: 138,198,097 S1584T probably benign Het
Enpp1 A T 10: 24,679,248 C67S probably null Het
Enpp5 C T 17: 44,081,136 T152I probably damaging Het
Erbb4 T C 1: 68,343,900 M313V probably damaging Het
Erc2 T G 14: 27,776,881 L238R probably damaging Het
Eya3 T A 4: 132,721,387 probably benign Het
Farp1 T C 14: 121,238,787 F339L probably damaging Het
Gap43 G T 16: 42,292,218 P60Q probably benign Het
Gatsl3 A G 11: 4,219,004 E57G possibly damaging Het
Gpr37l1 T A 1: 135,167,045 I154F probably damaging Het
Greb1 A G 12: 16,696,328 S1314P probably damaging Het
Hectd4 A T 5: 121,348,442 M3167L probably benign Het
Hps3 C T 3: 20,030,410 probably null Het
Hps5 A G 7: 46,786,589 C178R probably benign Het
Hspg2 T A 4: 137,570,073 probably benign Het
Impdh2-ps A G 8: 100,031,207 noncoding transcript Het
Josd2 T A 7: 44,471,254 N138K probably damaging Het
Mtmr6 T G 14: 60,292,097 M315R probably damaging Het
Mtrf1 G A 14: 79,413,080 V323M probably damaging Het
Myo16 G T 8: 10,373,527 G288W probably damaging Het
Myo18a T C 11: 77,823,323 Y748H probably damaging Het
Narfl A T 17: 25,781,309 H322L probably damaging Het
Nek1 A T 8: 61,098,511 N853I probably benign Het
Npnt T G 3: 132,904,691 T272P possibly damaging Het
Olfr11 T A 13: 21,639,170 M118L possibly damaging Het
Olfr1390 G A 11: 49,341,321 G263D probably benign Het
Olfr558 T A 7: 102,710,171 I304N probably damaging Het
Olfr668 G A 7: 104,924,810 T318I possibly damaging Het
Olfr694 C A 7: 106,689,144 E196* probably null Het
Olfr76 A G 19: 12,119,870 Y269H possibly damaging Het
Pappa2 T G 1: 158,957,002 D146A probably damaging Het
Pappa2 T C 1: 158,957,012 R143G probably benign Het
Pcsk9 C T 4: 106,447,156 G496R probably damaging Het
Pes1 A G 11: 3,964,058 K8E probably damaging Het
Phlpp2 G A 8: 109,940,420 G1194S probably damaging Het
Pkn1 A C 8: 83,671,749 V763G probably damaging Het
Pkp2 C A 16: 16,230,724 A331E probably damaging Het
Plb1 T A 5: 32,349,679 probably null Het
Plxna1 A T 6: 89,332,675 probably null Het
Polq C T 16: 37,041,747 T264M probably damaging Het
Prkag3 T C 1: 74,740,705 *490W probably null Het
Prl2c1 T C 13: 27,857,678 C228R probably damaging Het
Pus7l T C 15: 94,540,710 S85G probably benign Het
Rfc3 A C 5: 151,644,776 probably benign Het
Riox2 A G 16: 59,489,369 N362S probably benign Het
Rnf219 C T 14: 104,510,383 D43N probably damaging Het
Scaper A T 9: 55,743,648 D904E probably damaging Het
Scn11a T C 9: 119,754,561 M1663V probably benign Het
Slc13a3 A T 2: 165,430,289 I278N possibly damaging Het
Slc22a7 T C 17: 46,434,997 E278G probably damaging Het
Snrnp48 T A 13: 38,209,917 M66K probably damaging Het
Styk1 T G 6: 131,300,466 E404A probably damaging Het
Synj1 T A 16: 90,955,419 H1016L probably benign Het
Tbc1d8 G A 1: 39,402,878 T211I possibly damaging Het
Tjp2 T C 19: 24,120,111 probably null Het
Tmem87a A G 2: 120,360,037 probably null Het
Trappc9 T G 15: 72,937,060 Y718S probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Ugt2a3 C T 5: 87,327,195 G397R probably damaging Het
Wdr33 T A 18: 31,886,086 M454K probably benign Het
Wdtc1 G T 4: 133,301,799 N325K possibly damaging Het
Whrn T C 4: 63,418,165 H720R probably damaging Het
Xirp2 A T 2: 67,519,265 D3268V probably damaging Het
Zc3h7a A T 16: 11,141,709 H793Q probably damaging Het
Zfp518b C T 5: 38,674,498 A55T possibly damaging Het
Zmynd8 G A 2: 165,805,329 T901M probably damaging Het
Other mutations in Fsip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Fsip2 APN 2 82990386 missense probably benign 0.18
IGL00557:Fsip2 APN 2 82991313 missense possibly damaging 0.53
IGL01343:Fsip2 APN 2 82999819 missense possibly damaging 0.53
IGL01387:Fsip2 APN 2 82992982 missense possibly damaging 0.71
IGL01523:Fsip2 APN 2 82977519 missense probably benign
IGL01554:Fsip2 APN 2 82977278 missense possibly damaging 0.68
IGL01650:Fsip2 APN 2 82991086 missense probably benign 0.33
IGL01809:Fsip2 APN 2 82978347 missense possibly damaging 0.80
IGL01826:Fsip2 APN 2 82982639 missense probably benign 0.18
IGL01830:Fsip2 APN 2 82984929 missense probably benign
IGL01918:Fsip2 APN 2 82992138 missense possibly damaging 0.71
IGL01932:Fsip2 APN 2 82994005 missense possibly damaging 0.71
IGL01989:Fsip2 APN 2 82993867 missense probably damaging 0.99
IGL02096:Fsip2 APN 2 82991860 missense possibly damaging 0.85
IGL02153:Fsip2 APN 2 82978721 missense probably benign
IGL02155:Fsip2 APN 2 82998352 missense probably benign
IGL02219:Fsip2 APN 2 82977830 missense probably benign 0.07
IGL02248:Fsip2 APN 2 82982772 missense possibly damaging 0.73
IGL02316:Fsip2 APN 2 82978793 missense probably benign
IGL02478:Fsip2 APN 2 82984392 missense probably benign 0.00
IGL02504:Fsip2 APN 2 82978855 missense possibly damaging 0.83
IGL02572:Fsip2 APN 2 82992003 missense probably benign 0.32
IGL02625:Fsip2 APN 2 82949492 missense probably benign 0.00
IGL02665:Fsip2 APN 2 82993063 missense probably damaging 1.00
IGL02668:Fsip2 APN 2 82998318 missense probably benign 0.06
IGL02676:Fsip2 APN 2 82982157 missense possibly damaging 0.53
IGL02717:Fsip2 APN 2 82951026 splice site probably benign
IGL02805:Fsip2 APN 2 82993495 missense probably benign 0.01
IGL02943:Fsip2 APN 2 82992357 missense probably benign 0.32
IGL02965:Fsip2 APN 2 82983054 missense probably benign 0.33
IGL03001:Fsip2 APN 2 82990624 intron probably benign
IGL03076:Fsip2 APN 2 82982138 missense possibly damaging 0.96
IGL03229:Fsip2 APN 2 82978076 missense possibly damaging 0.86
IGL03353:Fsip2 APN 2 82977393 missense possibly damaging 0.85
IGL03401:Fsip2 APN 2 82990470 missense probably benign
D4186:Fsip2 UTSW 2 82988412 missense probably benign 0.32
FR4976:Fsip2 UTSW 2 82984362 critical splice acceptor site probably benign
FR4976:Fsip2 UTSW 2 82984365 critical splice acceptor site probably benign
R0017:Fsip2 UTSW 2 82992072 missense probably damaging 0.98
R0017:Fsip2 UTSW 2 82992072 missense probably damaging 0.98
R0021:Fsip2 UTSW 2 82999857 splice site probably benign
R0054:Fsip2 UTSW 2 82976608 missense probably damaging 0.96
R0054:Fsip2 UTSW 2 82986955 missense possibly damaging 0.85
R0054:Fsip2 UTSW 2 82986955 missense possibly damaging 0.85
R0104:Fsip2 UTSW 2 82978973 missense possibly damaging 0.91
R0104:Fsip2 UTSW 2 82978973 missense possibly damaging 0.91
R0127:Fsip2 UTSW 2 82984925 missense probably benign 0.28
R0131:Fsip2 UTSW 2 82991121 missense probably benign
R0149:Fsip2 UTSW 2 82975505 missense possibly damaging 0.93
R0167:Fsip2 UTSW 2 82980807 missense possibly damaging 0.53
R0190:Fsip2 UTSW 2 82985177 missense possibly damaging 0.73
R0323:Fsip2 UTSW 2 82985896 missense probably benign 0.33
R0358:Fsip2 UTSW 2 82983333 missense possibly damaging 0.56
R0361:Fsip2 UTSW 2 82975505 missense possibly damaging 0.93
R0369:Fsip2 UTSW 2 82984564 missense probably benign 0.33
R0394:Fsip2 UTSW 2 82991075 missense possibly damaging 0.70
R0532:Fsip2 UTSW 2 82977785 missense probably benign 0.33
R0595:Fsip2 UTSW 2 82946952 missense probably damaging 0.99
R0613:Fsip2 UTSW 2 82993795 missense probably damaging 0.99
R0614:Fsip2 UTSW 2 82977533 missense probably benign 0.15
R0619:Fsip2 UTSW 2 82944140 missense probably damaging 1.00
R0626:Fsip2 UTSW 2 82988958 missense probably benign 0.06
R0644:Fsip2 UTSW 2 82976897 missense probably benign 0.02
R0661:Fsip2 UTSW 2 82986169 missense possibly damaging 0.92
R0680:Fsip2 UTSW 2 82991359 missense possibly damaging 0.73
R0688:Fsip2 UTSW 2 82982339 missense probably benign 0.18
R0881:Fsip2 UTSW 2 82986273 missense possibly damaging 0.52
R0919:Fsip2 UTSW 2 82985484 missense possibly damaging 0.53
R0973:Fsip2 UTSW 2 82977092 missense probably benign 0.05
R0973:Fsip2 UTSW 2 82977092 missense probably benign 0.05
R0974:Fsip2 UTSW 2 82977092 missense probably benign 0.05
R0976:Fsip2 UTSW 2 82998031 missense possibly damaging 0.92
R1025:Fsip2 UTSW 2 82989436 nonsense probably null
R1026:Fsip2 UTSW 2 82988461 missense possibly damaging 0.52
R1140:Fsip2 UTSW 2 82975034 missense probably damaging 0.99
R1170:Fsip2 UTSW 2 82991500 missense possibly damaging 0.72
R1180:Fsip2 UTSW 2 82975226 missense probably damaging 0.99
R1188:Fsip2 UTSW 2 82975017 missense possibly damaging 0.96
R1226:Fsip2 UTSW 2 82981011 missense probably damaging 0.96
R1248:Fsip2 UTSW 2 82989763 missense possibly damaging 0.93
R1273:Fsip2 UTSW 2 82989408 missense possibly damaging 0.92
R1323:Fsip2 UTSW 2 82985752 missense probably damaging 1.00
R1323:Fsip2 UTSW 2 82985752 missense probably damaging 1.00
R1356:Fsip2 UTSW 2 82989745 missense probably benign 0.38
R1413:Fsip2 UTSW 2 82988418 missense possibly damaging 0.93
R1430:Fsip2 UTSW 2 82998063 missense possibly damaging 0.71
R1475:Fsip2 UTSW 2 82987195 missense probably damaging 0.99
R1489:Fsip2 UTSW 2 82979811 missense probably benign
R1520:Fsip2 UTSW 2 82980714 missense possibly damaging 0.96
R1543:Fsip2 UTSW 2 82981587 missense possibly damaging 0.91
R1581:Fsip2 UTSW 2 82986282 missense probably damaging 0.98
R1590:Fsip2 UTSW 2 82982787 missense probably benign 0.26
R1646:Fsip2 UTSW 2 82978517 missense probably benign 0.07
R1678:Fsip2 UTSW 2 82986345 missense probably benign
R1700:Fsip2 UTSW 2 82991737 missense probably benign 0.33
R1717:Fsip2 UTSW 2 82974945 missense possibly damaging 0.68
R1741:Fsip2 UTSW 2 82989912 missense probably benign 0.32
R1760:Fsip2 UTSW 2 82984896 missense probably benign 0.07
R1760:Fsip2 UTSW 2 82987711 missense possibly damaging 0.71
R1760:Fsip2 UTSW 2 82999841 missense possibly damaging 0.85
R1789:Fsip2 UTSW 2 82977562 missense probably benign 0.00
R1850:Fsip2 UTSW 2 82984589 missense possibly damaging 0.72
R1854:Fsip2 UTSW 2 82993257 missense possibly damaging 0.84
R1888:Fsip2 UTSW 2 82944160 missense probably benign 0.04
R1888:Fsip2 UTSW 2 82944160 missense probably benign 0.04
R1905:Fsip2 UTSW 2 82983428 missense possibly damaging 0.93
R1907:Fsip2 UTSW 2 82983428 missense possibly damaging 0.93
R1920:Fsip2 UTSW 2 82986820 missense probably benign 0.04
R1921:Fsip2 UTSW 2 82980783 nonsense probably null
R1921:Fsip2 UTSW 2 82986820 missense probably benign 0.04
R1931:Fsip2 UTSW 2 82986733 missense probably damaging 0.99
R1934:Fsip2 UTSW 2 82980558 missense possibly damaging 0.91
R1959:Fsip2 UTSW 2 82991550 missense probably benign
R1965:Fsip2 UTSW 2 82992780 missense possibly damaging 0.86
R1966:Fsip2 UTSW 2 82992780 missense possibly damaging 0.86
R1983:Fsip2 UTSW 2 82979831 missense probably benign
R1988:Fsip2 UTSW 2 82976517 missense possibly damaging 0.56
R2016:Fsip2 UTSW 2 82982732 missense possibly damaging 0.53
R2017:Fsip2 UTSW 2 82982732 missense possibly damaging 0.53
R2026:Fsip2 UTSW 2 82989444 missense possibly damaging 0.71
R2034:Fsip2 UTSW 2 82989494 missense probably benign 0.43
R2037:Fsip2 UTSW 2 82978512 missense probably damaging 0.99
R2070:Fsip2 UTSW 2 82976355 missense probably damaging 0.98
R2072:Fsip2 UTSW 2 83008815 missense possibly damaging 0.53
R2075:Fsip2 UTSW 2 82988579 missense possibly damaging 0.85
R2143:Fsip2 UTSW 2 82990271 missense possibly damaging 0.93
R2207:Fsip2 UTSW 2 82977479 missense probably benign 0.02
R2256:Fsip2 UTSW 2 82962751 missense probably benign 0.07
R2315:Fsip2 UTSW 2 82975093 missense probably benign
R2344:Fsip2 UTSW 2 82989913 missense possibly damaging 0.71
R2377:Fsip2 UTSW 2 82976249 missense probably benign 0.29
R2403:Fsip2 UTSW 2 82980720 missense possibly damaging 0.53
R2441:Fsip2 UTSW 2 82985341 missense possibly damaging 0.53
R2504:Fsip2 UTSW 2 82979610 missense possibly damaging 0.86
R2510:Fsip2 UTSW 2 82986438 missense probably benign
R2511:Fsip2 UTSW 2 82951657 missense probably damaging 1.00
R2511:Fsip2 UTSW 2 82986438 missense probably benign
R2512:Fsip2 UTSW 2 82978167 missense probably benign 0.04
R2568:Fsip2 UTSW 2 82990431 missense probably benign 0.14
R2656:Fsip2 UTSW 2 82979045 missense possibly damaging 0.83
R2883:Fsip2 UTSW 2 82991524 missense possibly damaging 0.86
R3417:Fsip2 UTSW 2 82986510 missense possibly damaging 0.51
R3431:Fsip2 UTSW 2 82992010 missense possibly damaging 0.85
R3441:Fsip2 UTSW 2 82986727 missense probably benign 0.00
R3605:Fsip2 UTSW 2 82984909 missense probably benign 0.28
R3620:Fsip2 UTSW 2 82980258 missense probably benign 0.00
R3621:Fsip2 UTSW 2 82980258 missense probably benign 0.00
R3726:Fsip2 UTSW 2 82988967 missense possibly damaging 0.84
R3755:Fsip2 UTSW 2 82978217 missense probably benign 0.26
R3789:Fsip2 UTSW 2 82982714 missense probably damaging 0.96
R3836:Fsip2 UTSW 2 82950946 missense probably damaging 1.00
R3844:Fsip2 UTSW 2 82989606 missense possibly damaging 0.52
R3846:Fsip2 UTSW 2 82986415 missense possibly damaging 0.52
R3861:Fsip2 UTSW 2 82984776 missense probably damaging 0.98
R3981:Fsip2 UTSW 2 82958662 missense probably benign 0.08
R4014:Fsip2 UTSW 2 82983518 missense probably benign
R4042:Fsip2 UTSW 2 82983552 missense probably benign 0.02
R4075:Fsip2 UTSW 2 82982901 missense probably benign 0.26
R4154:Fsip2 UTSW 2 82987069 missense possibly damaging 0.71
R4210:Fsip2 UTSW 2 82975149 missense probably damaging 0.99
R4211:Fsip2 UTSW 2 82975149 missense probably damaging 0.99
R4327:Fsip2 UTSW 2 82987059 missense probably benign 0.25
R4332:Fsip2 UTSW 2 82977857 missense probably benign 0.00
R4440:Fsip2 UTSW 2 82991206 missense possibly damaging 0.85
R4454:Fsip2 UTSW 2 82990776 missense possibly damaging 0.70
R4455:Fsip2 UTSW 2 82990776 missense possibly damaging 0.70
R4457:Fsip2 UTSW 2 82990776 missense possibly damaging 0.70
R4458:Fsip2 UTSW 2 82990776 missense possibly damaging 0.70
R4540:Fsip2 UTSW 2 82951665 missense probably benign
R4549:Fsip2 UTSW 2 82989628 missense probably damaging 0.99
R4558:Fsip2 UTSW 2 82984953 missense possibly damaging 0.73
R4573:Fsip2 UTSW 2 82986166 missense possibly damaging 0.71
R4583:Fsip2 UTSW 2 82978673 missense probably benign 0.33
R4618:Fsip2 UTSW 2 82987759 missense probably benign
R4700:Fsip2 UTSW 2 82987029 missense probably benign 0.32
R4716:Fsip2 UTSW 2 82974859 missense probably damaging 0.96
R4749:Fsip2 UTSW 2 82989285 missense probably benign 0.06
R4791:Fsip2 UTSW 2 82982108 missense possibly damaging 0.53
R4793:Fsip2 UTSW 2 82987700 nonsense probably null
R4819:Fsip2 UTSW 2 82988442 missense probably benign 0.06
R4832:Fsip2 UTSW 2 82990171 missense possibly damaging 0.92
R4840:Fsip2 UTSW 2 82949395 missense probably benign 0.01
R4840:Fsip2 UTSW 2 82985471 missense probably benign 0.26
R4865:Fsip2 UTSW 2 82990951 missense possibly damaging 0.86
R4876:Fsip2 UTSW 2 82974858 missense possibly damaging 0.91
R4885:Fsip2 UTSW 2 82988094 missense probably benign 0.02
R4911:Fsip2 UTSW 2 82981493 missense possibly damaging 0.85
R4918:Fsip2 UTSW 2 82993770 missense possibly damaging 0.51
R4936:Fsip2 UTSW 2 82985040 missense probably benign 0.18
R4950:Fsip2 UTSW 2 82946932 missense probably damaging 0.97
R4950:Fsip2 UTSW 2 82977414 missense probably benign 0.03
R4959:Fsip2 UTSW 2 82984825 missense probably benign 0.00
R4971:Fsip2 UTSW 2 82985878 missense probably benign 0.38
R4973:Fsip2 UTSW 2 82984825 missense probably benign 0.00
R4976:Fsip2 UTSW 2 82988191 missense probably damaging 0.99
R5022:Fsip2 UTSW 2 82979429 missense probably benign 0.33
R5027:Fsip2 UTSW 2 82989133 missense possibly damaging 0.71
R5030:Fsip2 UTSW 2 82988492 missense possibly damaging 0.85
R5048:Fsip2 UTSW 2 82993150 missense probably damaging 0.97
R5096:Fsip2 UTSW 2 82991116 missense probably benign 0.00
R5097:Fsip2 UTSW 2 82991985 missense probably benign
R5119:Fsip2 UTSW 2 82988191 missense probably damaging 0.99
R5138:Fsip2 UTSW 2 82981424 missense probably benign 0.12
R5152:Fsip2 UTSW 2 82978572 missense probably benign 0.43
R5174:Fsip2 UTSW 2 82980741 missense probably benign 0.07
R5193:Fsip2 UTSW 2 82982994 missense possibly damaging 0.53
R5245:Fsip2 UTSW 2 82993161 missense probably benign 0.02
R5282:Fsip2 UTSW 2 82978581 missense possibly damaging 0.61
R5323:Fsip2 UTSW 2 82988145 missense possibly damaging 0.71
R5326:Fsip2 UTSW 2 82981863 missense possibly damaging 0.84
R5378:Fsip2 UTSW 2 82989841 missense possibly damaging 0.71
R5380:Fsip2 UTSW 2 82975398 missense possibly damaging 0.91
R5396:Fsip2 UTSW 2 82990918 missense probably benign 0.00
R5422:Fsip2 UTSW 2 82982228 missense probably benign 0.00
R5481:Fsip2 UTSW 2 82979886 missense probably benign 0.26
R5482:Fsip2 UTSW 2 82985310 missense possibly damaging 0.80
R5513:Fsip2 UTSW 2 82950908 missense probably damaging 1.00
R5513:Fsip2 UTSW 2 82950912 missense probably benign 0.07
R5513:Fsip2 UTSW 2 82985198 missense possibly damaging 0.72
R5536:Fsip2 UTSW 2 82987059 missense probably benign 0.25
R5542:Fsip2 UTSW 2 82981863 missense possibly damaging 0.84
R5553:Fsip2 UTSW 2 82962746 missense probably benign
R5568:Fsip2 UTSW 2 82986564 missense probably benign 0.25
R5581:Fsip2 UTSW 2 82998128 missense possibly damaging 0.84
R5664:Fsip2 UTSW 2 82988095 missense probably benign 0.05
R5672:Fsip2 UTSW 2 82987494 nonsense probably null
R5712:Fsip2 UTSW 2 83008848 missense possibly damaging 0.73
R5762:Fsip2 UTSW 2 82977916 missense probably benign 0.33
R5772:Fsip2 UTSW 2 82984740 missense probably benign
R5881:Fsip2 UTSW 2 82984441 missense possibly damaging 0.72
R5919:Fsip2 UTSW 2 82992609 missense possibly damaging 0.71
R5920:Fsip2 UTSW 2 82988508 nonsense probably null
R5934:Fsip2 UTSW 2 82986748 missense possibly damaging 0.86
R5938:Fsip2 UTSW 2 82977491 missense probably benign 0.00
R5974:Fsip2 UTSW 2 82963313 missense possibly damaging 0.68
R5991:Fsip2 UTSW 2 82990468 missense probably benign 0.28
R6019:Fsip2 UTSW 2 82987939 missense possibly damaging 0.52
R6020:Fsip2 UTSW 2 82992127 missense probably damaging 0.99
R6056:Fsip2 UTSW 2 82985673 missense probably benign 0.01
R6057:Fsip2 UTSW 2 82979433 missense probably damaging 0.99
R6139:Fsip2 UTSW 2 82991044 missense possibly damaging 0.85
R6145:Fsip2 UTSW 2 82993768 missense possibly damaging 0.71
R6160:Fsip2 UTSW 2 82987945 nonsense probably null
R6161:Fsip2 UTSW 2 82987257 missense possibly damaging 0.80
R6166:Fsip2 UTSW 2 82980727 missense probably benign 0.00
R6187:Fsip2 UTSW 2 82982454 missense probably benign 0.33
R6196:Fsip2 UTSW 2 82989883 missense possibly damaging 0.71
R6217:Fsip2 UTSW 2 82988418 missense possibly damaging 0.93
R6276:Fsip2 UTSW 2 82980441 missense possibly damaging 0.91
R6278:Fsip2 UTSW 2 82988898 missense probably benign 0.16
R6349:Fsip2 UTSW 2 82993072 missense probably benign 0.05
R6351:Fsip2 UTSW 2 82992684 missense possibly damaging 0.51
R6401:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6404:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6405:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6437:Fsip2 UTSW 2 82983492 missense possibly damaging 0.73
R6478:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6479:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6480:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6481:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6521:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6529:Fsip2 UTSW 2 82982313 missense probably benign
R6621:Fsip2 UTSW 2 82989814 missense possibly damaging 0.93
R6639:Fsip2 UTSW 2 82983227 missense possibly damaging 0.85
R6649:Fsip2 UTSW 2 82967817 missense possibly damaging 0.83
R6714:Fsip2 UTSW 2 82979534 missense probably benign 0.01
R6714:Fsip2 UTSW 2 82990086 missense possibly damaging 0.71
R6749:Fsip2 UTSW 2 82978394 missense possibly damaging 0.85
R6765:Fsip2 UTSW 2 82986432 missense probably benign
R6790:Fsip2 UTSW 2 82990939 missense possibly damaging 0.53
R6793:Fsip2 UTSW 2 82989494 missense probably benign 0.43
R6795:Fsip2 UTSW 2 82980959 missense probably benign 0.08
R6818:Fsip2 UTSW 2 82985200 missense probably benign 0.04
R6844:Fsip2 UTSW 2 82983625 missense possibly damaging 0.72
R6848:Fsip2 UTSW 2 82982787 missense probably benign 0.26
R6945:Fsip2 UTSW 2 82992840 missense probably benign 0.16
R6950:Fsip2 UTSW 2 82985988 missense probably benign 0.03
R6951:Fsip2 UTSW 2 82981949 missense possibly damaging 0.68
R6974:Fsip2 UTSW 2 82978717 missense probably damaging 0.96
R6987:Fsip2 UTSW 2 82948286 nonsense probably null
R6989:Fsip2 UTSW 2 82976954 missense probably benign 0.00
X0018:Fsip2 UTSW 2 82982507 nonsense probably null
X0020:Fsip2 UTSW 2 82951020 missense probably damaging 1.00
X0025:Fsip2 UTSW 2 82954946 missense possibly damaging 0.70
X0027:Fsip2 UTSW 2 82976778 missense probably benign 0.35
X0066:Fsip2 UTSW 2 82987463 missense possibly damaging 0.51
Z1088:Fsip2 UTSW 2 82975448 missense probably damaging 0.96
Z1088:Fsip2 UTSW 2 82987653 missense possibly damaging 0.86
Z1088:Fsip2 UTSW 2 82988634 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- AAGGCAAGGACAGTCTGTGC -3'
(R):5'- TCAACATTGGAGAGCAACTCTTC -3'

Sequencing Primer
(F):5'- AAGGACAGTCTGTGCCTTCAC -3'
(R):5'- GGAGAGCAACTCTTCTCTTTCCG -3'
Posted On2015-11-11