Incidental Mutation 'R4739:Plb1'
ID359506
Institutional Source Beutler Lab
Gene Symbol Plb1
Ensembl Gene ENSMUSG00000029134
Gene Namephospholipase B1
Synonyms4930539A06Rik, 4632413E21Rik, 4930433E17Rik
MMRRC Submission 042025-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R4739 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location32232708-32366520 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to A at 32349679 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101376] [ENSMUST00000202220]
Predicted Effect probably null
Transcript: ENSMUST00000101376
SMART Domains Protein: ENSMUSP00000098927
Gene: ENSMUSG00000029134

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 57 69 N/A INTRINSIC
Pfam:Lipase_GDSL 398 672 4e-20 PFAM
Pfam:Lipase_GDSL 745 1019 1.7e-17 PFAM
Pfam:Lipase_GDSL 1101 1367 4.6e-15 PFAM
transmembrane domain 1420 1442 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000202220
SMART Domains Protein: ENSMUSP00000144040
Gene: ENSMUSG00000029134

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 57 69 N/A INTRINSIC
Pfam:Lipase_GDSL 398 672 4e-20 PFAM
Pfam:Lipase_GDSL 745 1019 1.7e-17 PFAM
Pfam:Lipase_GDSL 1101 1367 4.6e-15 PFAM
transmembrane domain 1420 1442 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202453
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202688
Meta Mutation Damage Score 0.644 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 96% (102/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-associated phospholipase that displays lysophospholipase and phospholipase A2 activities through removal of sn-1 and sn-2 fatty acids of glycerophospholipids. In addition, it displays lipase and retinyl ester hydrolase activities. The encoded protein is highly conserved and is composed of a large, glycosylated extracellular domain composed of four tandem homologous domains, followed by a hydrophobic segment that anchors the enzyme to the membrane and a short C-terminal cytoplasmic tail. This gene has been identified as a candidate rheumatoid arthritis risk gene. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012P17Rik C T 1: 158,969,334 noncoding transcript Het
2300002M23Rik A G 17: 35,567,506 probably benign Het
Aadat T C 8: 60,540,106 V360A probably benign Het
Abcc5 T A 16: 20,399,626 D283V probably damaging Het
Abraxas1 T A 5: 100,812,020 K155N probably damaging Het
Acot3 T C 12: 84,058,590 I277T probably benign Het
Ankrd45 G A 1: 161,155,390 C157Y probably damaging Het
Apol10a C T 15: 77,488,641 T159I possibly damaging Het
Arhgef11 G A 3: 87,697,999 V214M possibly damaging Het
Ash1l A C 3: 88,982,845 N677T probably benign Het
Atg13 A G 2: 91,684,695 S254P probably damaging Het
Atg16l2 A G 7: 101,297,178 L129P probably damaging Het
Avl9 T A 6: 56,726,309 V120D probably damaging Het
Cc2d1b T C 4: 108,628,042 V527A probably benign Het
Ccnl1 A G 3: 65,946,671 probably benign Het
Cenpl T A 1: 161,083,267 D261E probably damaging Het
Cep192 T G 18: 67,851,732 I1604M probably benign Het
Cep95 A G 11: 106,815,734 I573V probably benign Het
Cfap100 A G 6: 90,412,843 probably null Het
Cmc1 T A 9: 118,075,177 M49L probably benign Het
Cyfip2 G T 11: 46,279,993 N176K probably damaging Het
Cyp2w1 T C 5: 139,356,675 F408L probably damaging Het
D630045J12Rik G A 6: 38,196,036 S399F possibly damaging Het
Dcbld2 T A 16: 58,460,976 L528Q probably damaging Het
Dip2b T C 15: 100,207,777 V1138A probably damaging Het
Dip2c T A 13: 9,533,339 L119Q probably damaging Het
Dnah3 T C 7: 120,077,946 D444G possibly damaging Het
Dsg1c A T 18: 20,275,189 N432Y possibly damaging Het
Dst T A 1: 34,191,147 I2785N probably benign Het
Dynap A T 18: 70,241,225 Y77N possibly damaging Het
Eif4g3 T C 4: 138,183,199 L1330P possibly damaging Het
Eif4g3 T A 4: 138,198,097 S1584T probably benign Het
Enpp1 A T 10: 24,679,248 C67S probably null Het
Enpp5 C T 17: 44,081,136 T152I probably damaging Het
Erbb4 T C 1: 68,343,900 M313V probably damaging Het
Erc2 T G 14: 27,776,881 L238R probably damaging Het
Eya3 T A 4: 132,721,387 probably benign Het
Farp1 T C 14: 121,238,787 F339L probably damaging Het
Fsip2 A C 2: 82,975,353 D672A possibly damaging Het
Gap43 G T 16: 42,292,218 P60Q probably benign Het
Gatsl3 A G 11: 4,219,004 E57G possibly damaging Het
Gpr37l1 T A 1: 135,167,045 I154F probably damaging Het
Greb1 A G 12: 16,696,328 S1314P probably damaging Het
Hectd4 A T 5: 121,348,442 M3167L probably benign Het
Hps3 C T 3: 20,030,410 probably null Het
Hps5 A G 7: 46,786,589 C178R probably benign Het
Hspg2 T A 4: 137,570,073 probably benign Het
Impdh2-ps A G 8: 100,031,207 noncoding transcript Het
Josd2 T A 7: 44,471,254 N138K probably damaging Het
Mtmr6 T G 14: 60,292,097 M315R probably damaging Het
Mtrf1 G A 14: 79,413,080 V323M probably damaging Het
Myo16 G T 8: 10,373,527 G288W probably damaging Het
Myo18a T C 11: 77,823,323 Y748H probably damaging Het
Narfl A T 17: 25,781,309 H322L probably damaging Het
Nek1 A T 8: 61,098,511 N853I probably benign Het
Npnt T G 3: 132,904,691 T272P possibly damaging Het
Olfr11 T A 13: 21,639,170 M118L possibly damaging Het
Olfr1390 G A 11: 49,341,321 G263D probably benign Het
Olfr558 T A 7: 102,710,171 I304N probably damaging Het
Olfr668 G A 7: 104,924,810 T318I possibly damaging Het
Olfr694 C A 7: 106,689,144 E196* probably null Het
Olfr76 A G 19: 12,119,870 Y269H possibly damaging Het
Pappa2 T G 1: 158,957,002 D146A probably damaging Het
Pappa2 T C 1: 158,957,012 R143G probably benign Het
Pcsk9 C T 4: 106,447,156 G496R probably damaging Het
Pes1 A G 11: 3,964,058 K8E probably damaging Het
Phlpp2 G A 8: 109,940,420 G1194S probably damaging Het
Pkn1 A C 8: 83,671,749 V763G probably damaging Het
Pkp2 C A 16: 16,230,724 A331E probably damaging Het
Plxna1 A T 6: 89,332,675 probably null Het
Polq C T 16: 37,041,747 T264M probably damaging Het
Prkag3 T C 1: 74,740,705 *490W probably null Het
Prl2c1 T C 13: 27,857,678 C228R probably damaging Het
Pus7l T C 15: 94,540,710 S85G probably benign Het
Rfc3 A C 5: 151,644,776 probably benign Het
Riox2 A G 16: 59,489,369 N362S probably benign Het
Rnf219 C T 14: 104,510,383 D43N probably damaging Het
Scaper A T 9: 55,743,648 D904E probably damaging Het
Scn11a T C 9: 119,754,561 M1663V probably benign Het
Slc13a3 A T 2: 165,430,289 I278N possibly damaging Het
Slc22a7 T C 17: 46,434,997 E278G probably damaging Het
Snrnp48 T A 13: 38,209,917 M66K probably damaging Het
Styk1 T G 6: 131,300,466 E404A probably damaging Het
Synj1 T A 16: 90,955,419 H1016L probably benign Het
Tbc1d8 G A 1: 39,402,878 T211I possibly damaging Het
Tjp2 T C 19: 24,120,111 probably null Het
Tmem87a A G 2: 120,360,037 probably null Het
Trappc9 T G 15: 72,937,060 Y718S probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Ugt2a3 C T 5: 87,327,195 G397R probably damaging Het
Wdr33 T A 18: 31,886,086 M454K probably benign Het
Wdtc1 G T 4: 133,301,799 N325K possibly damaging Het
Whrn T C 4: 63,418,165 H720R probably damaging Het
Xirp2 A T 2: 67,519,265 D3268V probably damaging Het
Zc3h7a A T 16: 11,141,709 H793Q probably damaging Het
Zfp518b C T 5: 38,674,498 A55T possibly damaging Het
Zmynd8 G A 2: 165,805,329 T901M probably damaging Het
Other mutations in Plb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Plb1 APN 5 32345736 missense probably benign 0.00
IGL00542:Plb1 APN 5 32269834 missense probably benign 0.02
IGL00835:Plb1 APN 5 32364172 missense unknown
IGL00954:Plb1 APN 5 32298514 splice site probably benign
IGL01350:Plb1 APN 5 32317064 missense probably damaging 1.00
IGL01527:Plb1 APN 5 32317123 missense probably damaging 1.00
IGL01599:Plb1 APN 5 32342544 splice site probably benign
IGL01690:Plb1 APN 5 32313697 missense probably damaging 1.00
IGL01813:Plb1 APN 5 32329085 missense probably damaging 1.00
IGL01826:Plb1 APN 5 32281145 missense probably damaging 0.99
IGL02263:Plb1 APN 5 32321348 splice site probably benign
IGL02314:Plb1 APN 5 32281148 missense possibly damaging 0.93
IGL02649:Plb1 APN 5 32362568 missense probably benign 0.09
IGL02701:Plb1 APN 5 32364197 missense unknown
IGL02704:Plb1 APN 5 32353667 missense probably benign 0.03
IGL03170:Plb1 APN 5 32284902 missense probably damaging 0.99
IGL03182:Plb1 APN 5 32344915 splice site probably benign
IGL03326:Plb1 APN 5 32331327 missense probably benign 0.00
IGL03046:Plb1 UTSW 5 32328412 missense probably damaging 1.00
R0013:Plb1 UTSW 5 32349615 splice site probably benign
R0013:Plb1 UTSW 5 32349615 splice site probably benign
R0034:Plb1 UTSW 5 32273113 missense probably benign 0.16
R0034:Plb1 UTSW 5 32273113 missense probably benign 0.16
R0330:Plb1 UTSW 5 32355357 missense probably damaging 1.00
R0413:Plb1 UTSW 5 32355362 missense probably damaging 1.00
R0721:Plb1 UTSW 5 32364195 missense unknown
R0735:Plb1 UTSW 5 32284920 missense possibly damaging 0.90
R1423:Plb1 UTSW 5 32293257 missense probably benign
R1428:Plb1 UTSW 5 32264912 missense possibly damaging 0.82
R1469:Plb1 UTSW 5 32354826 missense possibly damaging 0.46
R1469:Plb1 UTSW 5 32354826 missense possibly damaging 0.46
R1694:Plb1 UTSW 5 32317277 missense probably null 0.01
R1801:Plb1 UTSW 5 32293243 missense probably damaging 1.00
R1804:Plb1 UTSW 5 32353697 missense possibly damaging 0.91
R1900:Plb1 UTSW 5 32286847 missense probably benign 0.44
R1903:Plb1 UTSW 5 32291238 missense probably damaging 1.00
R2101:Plb1 UTSW 5 32349660 missense probably damaging 1.00
R2153:Plb1 UTSW 5 32314089 missense probably damaging 1.00
R2207:Plb1 UTSW 5 32316640 missense possibly damaging 0.50
R2270:Plb1 UTSW 5 32293242 missense probably damaging 1.00
R2271:Plb1 UTSW 5 32293242 missense probably damaging 1.00
R2311:Plb1 UTSW 5 32269818 missense probably benign 0.01
R2850:Plb1 UTSW 5 32293224 missense probably benign
R3103:Plb1 UTSW 5 32328029 missense possibly damaging 0.92
R4444:Plb1 UTSW 5 32330565 missense probably benign 0.06
R4559:Plb1 UTSW 5 32332831 missense probably damaging 0.99
R4577:Plb1 UTSW 5 32247557 nonsense probably null
R4578:Plb1 UTSW 5 32247557 nonsense probably null
R4747:Plb1 UTSW 5 32349659 missense probably benign 0.08
R4806:Plb1 UTSW 5 32289852 missense probably damaging 1.00
R5406:Plb1 UTSW 5 32341915 missense probably damaging 1.00
R5567:Plb1 UTSW 5 32364199 missense unknown
R5574:Plb1 UTSW 5 32329947 missense probably benign 0.13
R5588:Plb1 UTSW 5 32329949 critical splice donor site probably null
R5619:Plb1 UTSW 5 32333497 missense probably damaging 0.99
R5769:Plb1 UTSW 5 32317522 missense probably benign 0.05
R6366:Plb1 UTSW 5 32314085 missense possibly damaging 0.59
R6700:Plb1 UTSW 5 32333464 missense probably damaging 0.99
X0018:Plb1 UTSW 5 32285883 missense probably benign 0.01
X0019:Plb1 UTSW 5 32353697 missense probably damaging 0.99
X0027:Plb1 UTSW 5 32270358 missense probably benign
X0028:Plb1 UTSW 5 32302675 missense probably damaging 1.00
Z1088:Plb1 UTSW 5 32310917 missense probably benign
Z1088:Plb1 UTSW 5 32310847 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTAAGACTCAGATCCTGCCC -3'
(R):5'- GTGATCTTGGCCAACTCCTC -3'

Sequencing Primer
(F):5'- GCTCCCTGGTGAGAAAAAGCC -3'
(R):5'- GGCCAACTCCTCATTCCAC -3'
Posted On2015-11-11