Incidental Mutation 'R4739:Phlpp2'
ID359531
Institutional Source Beutler Lab
Gene Symbol Phlpp2
Ensembl Gene ENSMUSG00000031732
Gene NamePH domain and leucine rich repeat protein phosphatase 2
SynonymsC130044A18Rik, Phlppl
MMRRC Submission 042025-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R4739 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location109868542-109944671 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 109940420 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 1194 (G1194S)
Ref Sequence ENSEMBL: ENSMUSP00000136166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034175] [ENSMUST00000179721]
Predicted Effect probably damaging
Transcript: ENSMUST00000034175
AA Change: G1159S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034175
Gene: ENSMUSG00000031732
AA Change: G1159S

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
Blast:PH 148 247 3e-61 BLAST
LRR 295 314 1.12e2 SMART
Pfam:LRR_7 319 335 3.5e-2 PFAM
LRR 341 363 2.82e0 SMART
LRR 364 387 9.75e0 SMART
LRR 456 479 2.68e1 SMART
LRR 498 517 1.35e1 SMART
LRR 521 540 5.59e1 SMART
LRR 544 563 2.79e1 SMART
LRR 569 589 1.62e1 SMART
LRR 590 609 1.67e1 SMART
LRR 616 641 1.33e2 SMART
LRR 640 659 1.4e1 SMART
LRR_TYP 664 687 6.78e-3 SMART
LRR 709 733 2.15e2 SMART
PP2Cc 772 1028 2.98e-30 SMART
low complexity region 1061 1095 N/A INTRINSIC
Blast:PP2Cc 1109 1175 8e-15 BLAST
low complexity region 1297 1315 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179721
AA Change: G1194S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136166
Gene: ENSMUSG00000031732
AA Change: G1194S

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
low complexity region 75 92 N/A INTRINSIC
Blast:PH 183 282 4e-61 BLAST
LRR 330 349 1.12e2 SMART
LRR 376 398 2.82e0 SMART
LRR 399 422 9.75e0 SMART
LRR 491 514 2.68e1 SMART
LRR 533 552 1.35e1 SMART
LRR 556 575 5.59e1 SMART
LRR 579 598 2.79e1 SMART
LRR 604 624 1.62e1 SMART
LRR 625 644 1.67e1 SMART
LRR 651 676 1.33e2 SMART
LRR 675 694 1.4e1 SMART
LRR_TYP 699 722 6.78e-3 SMART
LRR 744 768 2.15e2 SMART
PP2Cc 807 1063 2.98e-30 SMART
low complexity region 1096 1130 N/A INTRINSIC
Blast:PP2Cc 1144 1210 8e-15 BLAST
low complexity region 1332 1350 N/A INTRINSIC
Meta Mutation Damage Score 0.342 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 96% (102/106)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal susceptibility to DSS-induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012P17Rik C T 1: 158,969,334 noncoding transcript Het
2300002M23Rik A G 17: 35,567,506 probably benign Het
Aadat T C 8: 60,540,106 V360A probably benign Het
Abcc5 T A 16: 20,399,626 D283V probably damaging Het
Abraxas1 T A 5: 100,812,020 K155N probably damaging Het
Acot3 T C 12: 84,058,590 I277T probably benign Het
Ankrd45 G A 1: 161,155,390 C157Y probably damaging Het
Apol10a C T 15: 77,488,641 T159I possibly damaging Het
Arhgef11 G A 3: 87,697,999 V214M possibly damaging Het
Ash1l A C 3: 88,982,845 N677T probably benign Het
Atg13 A G 2: 91,684,695 S254P probably damaging Het
Atg16l2 A G 7: 101,297,178 L129P probably damaging Het
Avl9 T A 6: 56,726,309 V120D probably damaging Het
Cc2d1b T C 4: 108,628,042 V527A probably benign Het
Ccnl1 A G 3: 65,946,671 probably benign Het
Cenpl T A 1: 161,083,267 D261E probably damaging Het
Cep192 T G 18: 67,851,732 I1604M probably benign Het
Cep95 A G 11: 106,815,734 I573V probably benign Het
Cfap100 A G 6: 90,412,843 probably null Het
Cmc1 T A 9: 118,075,177 M49L probably benign Het
Cyfip2 G T 11: 46,279,993 N176K probably damaging Het
Cyp2w1 T C 5: 139,356,675 F408L probably damaging Het
D630045J12Rik G A 6: 38,196,036 S399F possibly damaging Het
Dcbld2 T A 16: 58,460,976 L528Q probably damaging Het
Dip2b T C 15: 100,207,777 V1138A probably damaging Het
Dip2c T A 13: 9,533,339 L119Q probably damaging Het
Dnah3 T C 7: 120,077,946 D444G possibly damaging Het
Dsg1c A T 18: 20,275,189 N432Y possibly damaging Het
Dst T A 1: 34,191,147 I2785N probably benign Het
Dynap A T 18: 70,241,225 Y77N possibly damaging Het
Eif4g3 T C 4: 138,183,199 L1330P possibly damaging Het
Eif4g3 T A 4: 138,198,097 S1584T probably benign Het
Enpp1 A T 10: 24,679,248 C67S probably null Het
Enpp5 C T 17: 44,081,136 T152I probably damaging Het
Erbb4 T C 1: 68,343,900 M313V probably damaging Het
Erc2 T G 14: 27,776,881 L238R probably damaging Het
Eya3 T A 4: 132,721,387 probably benign Het
Farp1 T C 14: 121,238,787 F339L probably damaging Het
Fsip2 A C 2: 82,975,353 D672A possibly damaging Het
Gap43 G T 16: 42,292,218 P60Q probably benign Het
Gatsl3 A G 11: 4,219,004 E57G possibly damaging Het
Gpr37l1 T A 1: 135,167,045 I154F probably damaging Het
Greb1 A G 12: 16,696,328 S1314P probably damaging Het
Hectd4 A T 5: 121,348,442 M3167L probably benign Het
Hps3 C T 3: 20,030,410 probably null Het
Hps5 A G 7: 46,786,589 C178R probably benign Het
Hspg2 T A 4: 137,570,073 probably benign Het
Impdh2-ps A G 8: 100,031,207 noncoding transcript Het
Josd2 T A 7: 44,471,254 N138K probably damaging Het
Mtmr6 T G 14: 60,292,097 M315R probably damaging Het
Mtrf1 G A 14: 79,413,080 V323M probably damaging Het
Myo16 G T 8: 10,373,527 G288W probably damaging Het
Myo18a T C 11: 77,823,323 Y748H probably damaging Het
Narfl A T 17: 25,781,309 H322L probably damaging Het
Nek1 A T 8: 61,098,511 N853I probably benign Het
Npnt T G 3: 132,904,691 T272P possibly damaging Het
Olfr11 T A 13: 21,639,170 M118L possibly damaging Het
Olfr1390 G A 11: 49,341,321 G263D probably benign Het
Olfr558 T A 7: 102,710,171 I304N probably damaging Het
Olfr668 G A 7: 104,924,810 T318I possibly damaging Het
Olfr694 C A 7: 106,689,144 E196* probably null Het
Olfr76 A G 19: 12,119,870 Y269H possibly damaging Het
Pappa2 T G 1: 158,957,002 D146A probably damaging Het
Pappa2 T C 1: 158,957,012 R143G probably benign Het
Pcsk9 C T 4: 106,447,156 G496R probably damaging Het
Pes1 A G 11: 3,964,058 K8E probably damaging Het
Pkn1 A C 8: 83,671,749 V763G probably damaging Het
Pkp2 C A 16: 16,230,724 A331E probably damaging Het
Plb1 T A 5: 32,349,679 probably null Het
Plxna1 A T 6: 89,332,675 probably null Het
Polq C T 16: 37,041,747 T264M probably damaging Het
Prkag3 T C 1: 74,740,705 *490W probably null Het
Prl2c1 T C 13: 27,857,678 C228R probably damaging Het
Pus7l T C 15: 94,540,710 S85G probably benign Het
Rfc3 A C 5: 151,644,776 probably benign Het
Riox2 A G 16: 59,489,369 N362S probably benign Het
Rnf219 C T 14: 104,510,383 D43N probably damaging Het
Scaper A T 9: 55,743,648 D904E probably damaging Het
Scn11a T C 9: 119,754,561 M1663V probably benign Het
Slc13a3 A T 2: 165,430,289 I278N possibly damaging Het
Slc22a7 T C 17: 46,434,997 E278G probably damaging Het
Snrnp48 T A 13: 38,209,917 M66K probably damaging Het
Styk1 T G 6: 131,300,466 E404A probably damaging Het
Synj1 T A 16: 90,955,419 H1016L probably benign Het
Tbc1d8 G A 1: 39,402,878 T211I possibly damaging Het
Tjp2 T C 19: 24,120,111 probably null Het
Tmem87a A G 2: 120,360,037 probably null Het
Trappc9 T G 15: 72,937,060 Y718S probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Ugt2a3 C T 5: 87,327,195 G397R probably damaging Het
Wdr33 T A 18: 31,886,086 M454K probably benign Het
Wdtc1 G T 4: 133,301,799 N325K possibly damaging Het
Whrn T C 4: 63,418,165 H720R probably damaging Het
Xirp2 A T 2: 67,519,265 D3268V probably damaging Het
Zc3h7a A T 16: 11,141,709 H793Q probably damaging Het
Zfp518b C T 5: 38,674,498 A55T possibly damaging Het
Zmynd8 G A 2: 165,805,329 T901M probably damaging Het
Other mutations in Phlpp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Phlpp2 APN 8 109925790 missense probably benign 0.01
IGL01363:Phlpp2 APN 8 109937097 missense probably benign 0.22
IGL01535:Phlpp2 APN 8 109934065 missense possibly damaging 0.82
IGL01815:Phlpp2 APN 8 109939859 missense probably benign
IGL02105:Phlpp2 APN 8 109904408 missense probably damaging 1.00
IGL02257:Phlpp2 APN 8 109920099 missense possibly damaging 0.88
IGL02318:Phlpp2 APN 8 109939873 missense probably benign 0.04
IGL02500:Phlpp2 APN 8 109913618 missense probably benign
IGL03356:Phlpp2 APN 8 109935617 missense probably benign 0.00
IGL03366:Phlpp2 APN 8 109940835 missense probably benign 0.44
R0142:Phlpp2 UTSW 8 109907513 missense probably damaging 1.00
R0144:Phlpp2 UTSW 8 109907513 missense probably damaging 1.00
R0374:Phlpp2 UTSW 8 109907513 missense probably damaging 1.00
R0420:Phlpp2 UTSW 8 109939935 missense probably damaging 0.99
R0426:Phlpp2 UTSW 8 109928463 missense probably benign 0.01
R0477:Phlpp2 UTSW 8 109895506 critical splice acceptor site probably null
R0529:Phlpp2 UTSW 8 109876971 missense probably benign 0.00
R0605:Phlpp2 UTSW 8 109933211 missense probably benign 0.00
R0655:Phlpp2 UTSW 8 109895587 missense probably benign 0.00
R0833:Phlpp2 UTSW 8 109937106 missense probably damaging 1.00
R0836:Phlpp2 UTSW 8 109937106 missense probably damaging 1.00
R1394:Phlpp2 UTSW 8 109877030 nonsense probably null
R1417:Phlpp2 UTSW 8 109940681 nonsense probably null
R1602:Phlpp2 UTSW 8 109934023 missense possibly damaging 0.96
R1650:Phlpp2 UTSW 8 109933955 splice site probably benign
R1815:Phlpp2 UTSW 8 109940223 missense probably damaging 1.00
R2045:Phlpp2 UTSW 8 109907600 missense probably damaging 1.00
R2072:Phlpp2 UTSW 8 109928492 missense possibly damaging 0.88
R2074:Phlpp2 UTSW 8 109928492 missense possibly damaging 0.88
R2075:Phlpp2 UTSW 8 109928492 missense possibly damaging 0.88
R2433:Phlpp2 UTSW 8 109940002 missense probably damaging 1.00
R3028:Phlpp2 UTSW 8 109907613 missense probably damaging 1.00
R4611:Phlpp2 UTSW 8 109876883 missense possibly damaging 0.79
R4718:Phlpp2 UTSW 8 109940820 missense probably benign 0.31
R4857:Phlpp2 UTSW 8 109877010 missense probably damaging 1.00
R5020:Phlpp2 UTSW 8 109940082 missense probably damaging 1.00
R5047:Phlpp2 UTSW 8 109913619 missense probably benign 0.04
R5074:Phlpp2 UTSW 8 109925829 missense probably damaging 0.99
R5330:Phlpp2 UTSW 8 109934035 missense probably damaging 0.99
R5663:Phlpp2 UTSW 8 109904344 missense probably benign 0.01
R5668:Phlpp2 UTSW 8 109928573 missense possibly damaging 0.67
R6433:Phlpp2 UTSW 8 109934685 missense probably benign
R6470:Phlpp2 UTSW 8 109937194 missense probably benign 0.45
R6804:Phlpp2 UTSW 8 109928565 missense probably damaging 1.00
X0018:Phlpp2 UTSW 8 109912369 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGATGTCCACCTCAGAGG -3'
(R):5'- TTCGCTGGCAGAAGTATACC -3'

Sequencing Primer
(F):5'- TCGGATGAGCACAACACTG -3'
(R):5'- CTGGCAGAAGTATACCACTGTTGAC -3'
Posted On2015-11-11