Incidental Mutation 'R4739:Synj1'
ID359562
Institutional Source Beutler Lab
Gene Symbol Synj1
Ensembl Gene ENSMUSG00000022973
Gene Namesynaptojanin 1
Synonyms
MMRRC Submission 042025-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4739 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location90936092-91011308 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 90955419 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 1016 (H1016L)
Ref Sequence ENSEMBL: ENSMUSP00000113308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121759] [ENSMUST00000170853] [ENSMUST00000231472]
Predicted Effect unknown
Transcript: ENSMUST00000118390
AA Change: H990L
SMART Domains Protein: ENSMUSP00000113518
Gene: ENSMUSG00000022973
AA Change: H990L

DomainStartEndE-ValueType
low complexity region 1 15 N/A INTRINSIC
Pfam:Syja_N 75 356 3.1e-71 PFAM
IPPc 546 889 6.37e-177 SMART
DUF1866 882 1024 1.24e-80 SMART
low complexity region 1040 1069 N/A INTRINSIC
low complexity region 1117 1151 N/A INTRINSIC
low complexity region 1155 1166 N/A INTRINSIC
low complexity region 1189 1208 N/A INTRINSIC
low complexity region 1289 1322 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121759
AA Change: H1016L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000113308
Gene: ENSMUSG00000022973
AA Change: H1016L

DomainStartEndE-ValueType
low complexity region 9 40 N/A INTRINSIC
Pfam:Syja_N 100 381 4.2e-71 PFAM
IPPc 571 914 6.37e-177 SMART
DUF1866 907 1049 1.24e-80 SMART
low complexity region 1065 1094 N/A INTRINSIC
low complexity region 1142 1176 N/A INTRINSIC
low complexity region 1180 1191 N/A INTRINSIC
low complexity region 1214 1233 N/A INTRINSIC
low complexity region 1314 1343 N/A INTRINSIC
Blast:IPPc 1344 1428 1e-17 BLAST
low complexity region 1564 1596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125032
SMART Domains Protein: ENSMUSP00000120399
Gene: ENSMUSG00000022973

DomainStartEndE-ValueType
low complexity region 3 32 N/A INTRINSIC
low complexity region 80 110 N/A INTRINSIC
low complexity region 123 142 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154276
SMART Domains Protein: ENSMUSP00000122675
Gene: ENSMUSG00000022973

DomainStartEndE-ValueType
low complexity region 2 32 N/A INTRINSIC
low complexity region 54 73 N/A INTRINSIC
low complexity region 154 187 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170853
AA Change: H976L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128997
Gene: ENSMUSG00000022973
AA Change: H976L

DomainStartEndE-ValueType
Pfam:Syja_N 59 346 1.7e-85 PFAM
IPPc 531 874 6.37e-177 SMART
DUF1866 867 1009 1.24e-80 SMART
low complexity region 1025 1054 N/A INTRINSIC
low complexity region 1102 1136 N/A INTRINSIC
low complexity region 1140 1151 N/A INTRINSIC
low complexity region 1174 1193 N/A INTRINSIC
low complexity region 1274 1307 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175515
Predicted Effect probably benign
Transcript: ENSMUST00000231472
Predicted Effect probably benign
Transcript: ENSMUST00000231524
Meta Mutation Damage Score 0.0616 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 96% (102/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphoinositide phosphatase that regulates levels of membrane phosphatidylinositol-4,5-bisphosphate. As such, expression of this enzyme may affect synaptic transmission and membrane trafficking. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit neurological defects associated with impaired phosphoinositide metabolism and accumulation of clathrin-coated vesicles at nerve endings. Mutants show impaired suckling and most die within 24 hours of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012P17Rik C T 1: 158,969,334 noncoding transcript Het
2300002M23Rik A G 17: 35,567,506 probably benign Het
Aadat T C 8: 60,540,106 V360A probably benign Het
Abcc5 T A 16: 20,399,626 D283V probably damaging Het
Abraxas1 T A 5: 100,812,020 K155N probably damaging Het
Acot3 T C 12: 84,058,590 I277T probably benign Het
Ankrd45 G A 1: 161,155,390 C157Y probably damaging Het
Apol10a C T 15: 77,488,641 T159I possibly damaging Het
Arhgef11 G A 3: 87,697,999 V214M possibly damaging Het
Ash1l A C 3: 88,982,845 N677T probably benign Het
Atg13 A G 2: 91,684,695 S254P probably damaging Het
Atg16l2 A G 7: 101,297,178 L129P probably damaging Het
Avl9 T A 6: 56,726,309 V120D probably damaging Het
Cc2d1b T C 4: 108,628,042 V527A probably benign Het
Ccnl1 A G 3: 65,946,671 probably benign Het
Cenpl T A 1: 161,083,267 D261E probably damaging Het
Cep192 T G 18: 67,851,732 I1604M probably benign Het
Cep95 A G 11: 106,815,734 I573V probably benign Het
Cfap100 A G 6: 90,412,843 probably null Het
Cmc1 T A 9: 118,075,177 M49L probably benign Het
Cyfip2 G T 11: 46,279,993 N176K probably damaging Het
Cyp2w1 T C 5: 139,356,675 F408L probably damaging Het
D630045J12Rik G A 6: 38,196,036 S399F possibly damaging Het
Dcbld2 T A 16: 58,460,976 L528Q probably damaging Het
Dip2b T C 15: 100,207,777 V1138A probably damaging Het
Dip2c T A 13: 9,533,339 L119Q probably damaging Het
Dnah3 T C 7: 120,077,946 D444G possibly damaging Het
Dsg1c A T 18: 20,275,189 N432Y possibly damaging Het
Dst T A 1: 34,191,147 I2785N probably benign Het
Dynap A T 18: 70,241,225 Y77N possibly damaging Het
Eif4g3 T C 4: 138,183,199 L1330P possibly damaging Het
Eif4g3 T A 4: 138,198,097 S1584T probably benign Het
Enpp1 A T 10: 24,679,248 C67S probably null Het
Enpp5 C T 17: 44,081,136 T152I probably damaging Het
Erbb4 T C 1: 68,343,900 M313V probably damaging Het
Erc2 T G 14: 27,776,881 L238R probably damaging Het
Eya3 T A 4: 132,721,387 probably benign Het
Farp1 T C 14: 121,238,787 F339L probably damaging Het
Fsip2 A C 2: 82,975,353 D672A possibly damaging Het
Gap43 G T 16: 42,292,218 P60Q probably benign Het
Gatsl3 A G 11: 4,219,004 E57G possibly damaging Het
Gpr37l1 T A 1: 135,167,045 I154F probably damaging Het
Greb1 A G 12: 16,696,328 S1314P probably damaging Het
Hectd4 A T 5: 121,348,442 M3167L probably benign Het
Hps3 C T 3: 20,030,410 probably null Het
Hps5 A G 7: 46,786,589 C178R probably benign Het
Hspg2 T A 4: 137,570,073 probably benign Het
Impdh2-ps A G 8: 100,031,207 noncoding transcript Het
Josd2 T A 7: 44,471,254 N138K probably damaging Het
Mtmr6 T G 14: 60,292,097 M315R probably damaging Het
Mtrf1 G A 14: 79,413,080 V323M probably damaging Het
Myo16 G T 8: 10,373,527 G288W probably damaging Het
Myo18a T C 11: 77,823,323 Y748H probably damaging Het
Narfl A T 17: 25,781,309 H322L probably damaging Het
Nek1 A T 8: 61,098,511 N853I probably benign Het
Npnt T G 3: 132,904,691 T272P possibly damaging Het
Olfr11 T A 13: 21,639,170 M118L possibly damaging Het
Olfr1390 G A 11: 49,341,321 G263D probably benign Het
Olfr558 T A 7: 102,710,171 I304N probably damaging Het
Olfr668 G A 7: 104,924,810 T318I possibly damaging Het
Olfr694 C A 7: 106,689,144 E196* probably null Het
Olfr76 A G 19: 12,119,870 Y269H possibly damaging Het
Pappa2 T G 1: 158,957,002 D146A probably damaging Het
Pappa2 T C 1: 158,957,012 R143G probably benign Het
Pcsk9 C T 4: 106,447,156 G496R probably damaging Het
Pes1 A G 11: 3,964,058 K8E probably damaging Het
Phlpp2 G A 8: 109,940,420 G1194S probably damaging Het
Pkn1 A C 8: 83,671,749 V763G probably damaging Het
Pkp2 C A 16: 16,230,724 A331E probably damaging Het
Plb1 T A 5: 32,349,679 probably null Het
Plxna1 A T 6: 89,332,675 probably null Het
Polq C T 16: 37,041,747 T264M probably damaging Het
Prkag3 T C 1: 74,740,705 *490W probably null Het
Prl2c1 T C 13: 27,857,678 C228R probably damaging Het
Pus7l T C 15: 94,540,710 S85G probably benign Het
Rfc3 A C 5: 151,644,776 probably benign Het
Riox2 A G 16: 59,489,369 N362S probably benign Het
Rnf219 C T 14: 104,510,383 D43N probably damaging Het
Scaper A T 9: 55,743,648 D904E probably damaging Het
Scn11a T C 9: 119,754,561 M1663V probably benign Het
Slc13a3 A T 2: 165,430,289 I278N possibly damaging Het
Slc22a7 T C 17: 46,434,997 E278G probably damaging Het
Snrnp48 T A 13: 38,209,917 M66K probably damaging Het
Styk1 T G 6: 131,300,466 E404A probably damaging Het
Tbc1d8 G A 1: 39,402,878 T211I possibly damaging Het
Tjp2 T C 19: 24,120,111 probably null Het
Tmem87a A G 2: 120,360,037 probably null Het
Trappc9 T G 15: 72,937,060 Y718S probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Ugt2a3 C T 5: 87,327,195 G397R probably damaging Het
Wdr33 T A 18: 31,886,086 M454K probably benign Het
Wdtc1 G T 4: 133,301,799 N325K possibly damaging Het
Whrn T C 4: 63,418,165 H720R probably damaging Het
Xirp2 A T 2: 67,519,265 D3268V probably damaging Het
Zc3h7a A T 16: 11,141,709 H793Q probably damaging Het
Zfp518b C T 5: 38,674,498 A55T possibly damaging Het
Zmynd8 G A 2: 165,805,329 T901M probably damaging Het
Other mutations in Synj1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Synj1 APN 16 90951976 missense probably damaging 1.00
IGL01468:Synj1 APN 16 91010172 splice site probably benign
IGL02209:Synj1 APN 16 90987419 missense probably damaging 0.97
IGL02452:Synj1 APN 16 90961365 splice site probably benign
IGL02619:Synj1 APN 16 90974045 missense probably damaging 1.00
IGL02650:Synj1 APN 16 90976696 missense probably benign 0.03
IGL02708:Synj1 APN 16 90991462 missense probably damaging 1.00
IGL02863:Synj1 APN 16 90961434 missense possibly damaging 0.94
IGL03131:Synj1 APN 16 90988168 missense probably damaging 0.99
IGL03295:Synj1 APN 16 90938430 missense probably benign 0.14
IGL03356:Synj1 APN 16 90987392 missense probably damaging 1.00
PIT1430001:Synj1 UTSW 16 90964508 missense probably damaging 1.00
R0179:Synj1 UTSW 16 90964631 missense possibly damaging 0.80
R0396:Synj1 UTSW 16 90938640 missense probably benign
R0426:Synj1 UTSW 16 90967354 missense probably damaging 1.00
R0486:Synj1 UTSW 16 90938263 utr 3 prime probably benign
R0515:Synj1 UTSW 16 90994022 missense possibly damaging 0.93
R0535:Synj1 UTSW 16 90948087 missense possibly damaging 0.80
R0697:Synj1 UTSW 16 90960615 missense probably benign 0.44
R0698:Synj1 UTSW 16 90960615 missense probably benign 0.44
R0945:Synj1 UTSW 16 90960445 missense possibly damaging 0.90
R1327:Synj1 UTSW 16 90946855 missense probably benign 0.05
R1562:Synj1 UTSW 16 90987402 missense probably benign 0.09
R1732:Synj1 UTSW 16 90964230 missense probably damaging 0.99
R1752:Synj1 UTSW 16 90938473 missense probably benign
R1785:Synj1 UTSW 16 90964517 missense probably damaging 1.00
R1786:Synj1 UTSW 16 90964517 missense probably damaging 1.00
R2011:Synj1 UTSW 16 90938696 missense probably damaging 1.00
R2012:Synj1 UTSW 16 90938696 missense probably damaging 1.00
R2065:Synj1 UTSW 16 90991649 critical splice acceptor site probably null
R2862:Synj1 UTSW 16 90969329 missense probably damaging 1.00
R3026:Synj1 UTSW 16 90978734 missense probably damaging 1.00
R3151:Synj1 UTSW 16 90960626 missense probably damaging 0.96
R3946:Synj1 UTSW 16 91010096 missense possibly damaging 0.48
R3971:Synj1 UTSW 16 90991603 missense probably damaging 1.00
R4472:Synj1 UTSW 16 90969181 critical splice donor site probably null
R4547:Synj1 UTSW 16 90988282 missense possibly damaging 0.51
R4647:Synj1 UTSW 16 90973989 missense probably damaging 1.00
R5027:Synj1 UTSW 16 90940519 intron probably null
R5428:Synj1 UTSW 16 90991518 missense probably damaging 0.98
R5586:Synj1 UTSW 16 91009977 intron probably benign
R5769:Synj1 UTSW 16 90938253 utr 3 prime probably benign
R6005:Synj1 UTSW 16 90969286 missense probably damaging 1.00
R6119:Synj1 UTSW 16 90938989 missense probably benign 0.30
R6313:Synj1 UTSW 16 90946815 missense probably benign 0.00
R6324:Synj1 UTSW 16 90938630 missense probably benign 0.00
R6549:Synj1 UTSW 16 90938677 missense probably benign
R6696:Synj1 UTSW 16 90960452 missense probably damaging 0.98
R6698:Synj1 UTSW 16 90960452 missense probably damaging 0.98
R6861:Synj1 UTSW 16 90963880 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAAACCCTTAGTGCTGGGACAAC -3'
(R):5'- TGGCCAGAGTGAAGGAATCC -3'

Sequencing Primer
(F):5'- GCTGGGACAACCTTCTCTAACATG -3'
(R):5'- GGCATCATAAGCTCTTAAAGGC -3'
Posted On2015-11-11