Incidental Mutation 'R4739:Slc22a7'
ID359566
Institutional Source Beutler Lab
Gene Symbol Slc22a7
Ensembl Gene ENSMUSG00000067144
Gene Namesolute carrier family 22 (organic anion transporter), member 7
SynonymsNLT, OAT2
MMRRC Submission 042025-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R4739 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location46432185-46438477 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46434997 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 278 (E278G)
Ref Sequence ENSEMBL: ENSMUSP00000084234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024764] [ENSMUST00000087012] [ENSMUST00000113465] [ENSMUST00000165993] [ENSMUST00000166852]
Predicted Effect probably benign
Transcript: ENSMUST00000024764
SMART Domains Protein: ENSMUSP00000024764
Gene: ENSMUSG00000023968

DomainStartEndE-ValueType
LIM 4 56 9.54e-12 SMART
LIM 123 175 2.19e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000087012
AA Change: E278G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000084234
Gene: ENSMUSG00000067144
AA Change: E278G

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:MFS_1 82 479 1.2e-32 PFAM
Pfam:Sugar_tr 86 524 2.5e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113465
SMART Domains Protein: ENSMUSP00000109092
Gene: ENSMUSG00000023968

DomainStartEndE-ValueType
LIM 4 56 9.54e-12 SMART
LIM 123 175 2.19e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164180
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165811
Predicted Effect probably benign
Transcript: ENSMUST00000165993
SMART Domains Protein: ENSMUSP00000130072
Gene: ENSMUSG00000023968

DomainStartEndE-ValueType
LIM 4 56 9.54e-12 SMART
LIM 123 175 2.19e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166852
SMART Domains Protein: ENSMUSP00000127966
Gene: ENSMUSG00000091742

DomainStartEndE-ValueType
Pfam:Ribosomal_L5 10 59 4.1e-18 PFAM
Pfam:Ribosomal_L5_C 63 161 8.7e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169441
Meta Mutation Damage Score 0.484 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 96% (102/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the sodium-independent transport and excretion of organic anions, some of which are potentially toxic. The encoded protein is an integral membrane protein and appears to be localized to the basolateral membrane of the kidney. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012P17Rik C T 1: 158,969,334 noncoding transcript Het
2300002M23Rik A G 17: 35,567,506 probably benign Het
Aadat T C 8: 60,540,106 V360A probably benign Het
Abcc5 T A 16: 20,399,626 D283V probably damaging Het
Abraxas1 T A 5: 100,812,020 K155N probably damaging Het
Acot3 T C 12: 84,058,590 I277T probably benign Het
Ankrd45 G A 1: 161,155,390 C157Y probably damaging Het
Apol10a C T 15: 77,488,641 T159I possibly damaging Het
Arhgef11 G A 3: 87,697,999 V214M possibly damaging Het
Ash1l A C 3: 88,982,845 N677T probably benign Het
Atg13 A G 2: 91,684,695 S254P probably damaging Het
Atg16l2 A G 7: 101,297,178 L129P probably damaging Het
Avl9 T A 6: 56,726,309 V120D probably damaging Het
Cc2d1b T C 4: 108,628,042 V527A probably benign Het
Ccnl1 A G 3: 65,946,671 probably benign Het
Cenpl T A 1: 161,083,267 D261E probably damaging Het
Cep192 T G 18: 67,851,732 I1604M probably benign Het
Cep95 A G 11: 106,815,734 I573V probably benign Het
Cfap100 A G 6: 90,412,843 probably null Het
Cmc1 T A 9: 118,075,177 M49L probably benign Het
Cyfip2 G T 11: 46,279,993 N176K probably damaging Het
Cyp2w1 T C 5: 139,356,675 F408L probably damaging Het
D630045J12Rik G A 6: 38,196,036 S399F possibly damaging Het
Dcbld2 T A 16: 58,460,976 L528Q probably damaging Het
Dip2b T C 15: 100,207,777 V1138A probably damaging Het
Dip2c T A 13: 9,533,339 L119Q probably damaging Het
Dnah3 T C 7: 120,077,946 D444G possibly damaging Het
Dsg1c A T 18: 20,275,189 N432Y possibly damaging Het
Dst T A 1: 34,191,147 I2785N probably benign Het
Dynap A T 18: 70,241,225 Y77N possibly damaging Het
Eif4g3 T C 4: 138,183,199 L1330P possibly damaging Het
Eif4g3 T A 4: 138,198,097 S1584T probably benign Het
Enpp1 A T 10: 24,679,248 C67S probably null Het
Enpp5 C T 17: 44,081,136 T152I probably damaging Het
Erbb4 T C 1: 68,343,900 M313V probably damaging Het
Erc2 T G 14: 27,776,881 L238R probably damaging Het
Eya3 T A 4: 132,721,387 probably benign Het
Farp1 T C 14: 121,238,787 F339L probably damaging Het
Fsip2 A C 2: 82,975,353 D672A possibly damaging Het
Gap43 G T 16: 42,292,218 P60Q probably benign Het
Gatsl3 A G 11: 4,219,004 E57G possibly damaging Het
Gpr37l1 T A 1: 135,167,045 I154F probably damaging Het
Greb1 A G 12: 16,696,328 S1314P probably damaging Het
Hectd4 A T 5: 121,348,442 M3167L probably benign Het
Hps3 C T 3: 20,030,410 probably null Het
Hps5 A G 7: 46,786,589 C178R probably benign Het
Hspg2 T A 4: 137,570,073 probably benign Het
Impdh2-ps A G 8: 100,031,207 noncoding transcript Het
Josd2 T A 7: 44,471,254 N138K probably damaging Het
Mtmr6 T G 14: 60,292,097 M315R probably damaging Het
Mtrf1 G A 14: 79,413,080 V323M probably damaging Het
Myo16 G T 8: 10,373,527 G288W probably damaging Het
Myo18a T C 11: 77,823,323 Y748H probably damaging Het
Narfl A T 17: 25,781,309 H322L probably damaging Het
Nek1 A T 8: 61,098,511 N853I probably benign Het
Npnt T G 3: 132,904,691 T272P possibly damaging Het
Olfr11 T A 13: 21,639,170 M118L possibly damaging Het
Olfr1390 G A 11: 49,341,321 G263D probably benign Het
Olfr558 T A 7: 102,710,171 I304N probably damaging Het
Olfr668 G A 7: 104,924,810 T318I possibly damaging Het
Olfr694 C A 7: 106,689,144 E196* probably null Het
Olfr76 A G 19: 12,119,870 Y269H possibly damaging Het
Pappa2 T G 1: 158,957,002 D146A probably damaging Het
Pappa2 T C 1: 158,957,012 R143G probably benign Het
Pcsk9 C T 4: 106,447,156 G496R probably damaging Het
Pes1 A G 11: 3,964,058 K8E probably damaging Het
Phlpp2 G A 8: 109,940,420 G1194S probably damaging Het
Pkn1 A C 8: 83,671,749 V763G probably damaging Het
Pkp2 C A 16: 16,230,724 A331E probably damaging Het
Plb1 T A 5: 32,349,679 probably null Het
Plxna1 A T 6: 89,332,675 probably null Het
Polq C T 16: 37,041,747 T264M probably damaging Het
Prkag3 T C 1: 74,740,705 *490W probably null Het
Prl2c1 T C 13: 27,857,678 C228R probably damaging Het
Pus7l T C 15: 94,540,710 S85G probably benign Het
Rfc3 A C 5: 151,644,776 probably benign Het
Riox2 A G 16: 59,489,369 N362S probably benign Het
Rnf219 C T 14: 104,510,383 D43N probably damaging Het
Scaper A T 9: 55,743,648 D904E probably damaging Het
Scn11a T C 9: 119,754,561 M1663V probably benign Het
Slc13a3 A T 2: 165,430,289 I278N possibly damaging Het
Snrnp48 T A 13: 38,209,917 M66K probably damaging Het
Styk1 T G 6: 131,300,466 E404A probably damaging Het
Synj1 T A 16: 90,955,419 H1016L probably benign Het
Tbc1d8 G A 1: 39,402,878 T211I possibly damaging Het
Tjp2 T C 19: 24,120,111 probably null Het
Tmem87a A G 2: 120,360,037 probably null Het
Trappc9 T G 15: 72,937,060 Y718S probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Ugt2a3 C T 5: 87,327,195 G397R probably damaging Het
Wdr33 T A 18: 31,886,086 M454K probably benign Het
Wdtc1 G T 4: 133,301,799 N325K possibly damaging Het
Whrn T C 4: 63,418,165 H720R probably damaging Het
Xirp2 A T 2: 67,519,265 D3268V probably damaging Het
Zc3h7a A T 16: 11,141,709 H793Q probably damaging Het
Zfp518b C T 5: 38,674,498 A55T possibly damaging Het
Zmynd8 G A 2: 165,805,329 T901M probably damaging Het
Other mutations in Slc22a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01638:Slc22a7 APN 17 46437994 splice site probably null
R0755:Slc22a7 UTSW 17 46438187 missense possibly damaging 0.93
R0898:Slc22a7 UTSW 17 46433149 missense probably damaging 1.00
R1594:Slc22a7 UTSW 17 46438031 missense possibly damaging 0.94
R1794:Slc22a7 UTSW 17 46433153 missense probably damaging 1.00
R1900:Slc22a7 UTSW 17 46438231 missense probably benign 0.00
R1973:Slc22a7 UTSW 17 46437090 missense probably damaging 1.00
R2117:Slc22a7 UTSW 17 46433972 missense possibly damaging 0.55
R4467:Slc22a7 UTSW 17 46432510 missense probably benign
R4921:Slc22a7 UTSW 17 46436933 missense probably benign 0.00
R6982:Slc22a7 UTSW 17 46434637 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTCGAAGCACACATGGAGG -3'
(R):5'- GCCTGAACCAAGCAGTAAGG -3'

Sequencing Primer
(F):5'- TCCAATGGAGAGCTGGCGTG -3'
(R):5'- GGAAGAGGTAGCTTTTAAACTGGGC -3'
Posted On2015-11-11