Incidental Mutation 'R4739:Wdr33'
ID359568
Institutional Source Beutler Lab
Gene Symbol Wdr33
Ensembl Gene ENSMUSG00000024400
Gene NameWD repeat domain 33
Synonyms2810021O11Rik, 1110001N06Rik, 8430413N20Rik, 2310011G05Rik, WDC146
MMRRC Submission 042025-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R4739 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location31804057-31908987 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31886086 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 454 (M454K)
Ref Sequence ENSEMBL: ENSMUSP00000025264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025264]
Predicted Effect probably benign
Transcript: ENSMUST00000025264
AA Change: M454K

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000025264
Gene: ENSMUSG00000024400
AA Change: M454K

DomainStartEndE-ValueType
WD40 107 147 2.15e-1 SMART
WD40 150 189 5.77e-5 SMART
WD40 191 230 1.89e-9 SMART
WD40 233 274 2.59e-7 SMART
WD40 277 316 2.73e-6 SMART
WD40 320 360 1.71e-7 SMART
WD40 364 403 1.52e-4 SMART
low complexity region 481 499 N/A INTRINSIC
coiled coil region 531 559 N/A INTRINSIC
low complexity region 573 587 N/A INTRINSIC
low complexity region 608 624 N/A INTRINSIC
low complexity region 628 668 N/A INTRINSIC
low complexity region 679 722 N/A INTRINSIC
low complexity region 725 761 N/A INTRINSIC
internal_repeat_1 778 803 3.47e-9 PROSPERO
low complexity region 806 818 N/A INTRINSIC
internal_repeat_1 821 845 3.47e-9 PROSPERO
low complexity region 848 881 N/A INTRINSIC
low complexity region 920 935 N/A INTRINSIC
low complexity region 938 951 N/A INTRINSIC
low complexity region 1000 1018 N/A INTRINSIC
low complexity region 1041 1049 N/A INTRINSIC
low complexity region 1057 1100 N/A INTRINSIC
low complexity region 1137 1154 N/A INTRINSIC
low complexity region 1190 1207 N/A INTRINSIC
low complexity region 1251 1262 N/A INTRINSIC
low complexity region 1287 1330 N/A INTRINSIC
Meta Mutation Damage Score 0.294 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 96% (102/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This gene is highly expressed in testis and the protein is localized to the nucleus. This gene may play important roles in the mechanisms of cytodifferentiation and/or DNA recombination. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012P17Rik C T 1: 158,969,334 noncoding transcript Het
2300002M23Rik A G 17: 35,567,506 probably benign Het
Aadat T C 8: 60,540,106 V360A probably benign Het
Abcc5 T A 16: 20,399,626 D283V probably damaging Het
Abraxas1 T A 5: 100,812,020 K155N probably damaging Het
Acot3 T C 12: 84,058,590 I277T probably benign Het
Ankrd45 G A 1: 161,155,390 C157Y probably damaging Het
Apol10a C T 15: 77,488,641 T159I possibly damaging Het
Arhgef11 G A 3: 87,697,999 V214M possibly damaging Het
Ash1l A C 3: 88,982,845 N677T probably benign Het
Atg13 A G 2: 91,684,695 S254P probably damaging Het
Atg16l2 A G 7: 101,297,178 L129P probably damaging Het
Avl9 T A 6: 56,726,309 V120D probably damaging Het
Cc2d1b T C 4: 108,628,042 V527A probably benign Het
Ccnl1 A G 3: 65,946,671 probably benign Het
Cenpl T A 1: 161,083,267 D261E probably damaging Het
Cep192 T G 18: 67,851,732 I1604M probably benign Het
Cep95 A G 11: 106,815,734 I573V probably benign Het
Cfap100 A G 6: 90,412,843 probably null Het
Cmc1 T A 9: 118,075,177 M49L probably benign Het
Cyfip2 G T 11: 46,279,993 N176K probably damaging Het
Cyp2w1 T C 5: 139,356,675 F408L probably damaging Het
D630045J12Rik G A 6: 38,196,036 S399F possibly damaging Het
Dcbld2 T A 16: 58,460,976 L528Q probably damaging Het
Dip2b T C 15: 100,207,777 V1138A probably damaging Het
Dip2c T A 13: 9,533,339 L119Q probably damaging Het
Dnah3 T C 7: 120,077,946 D444G possibly damaging Het
Dsg1c A T 18: 20,275,189 N432Y possibly damaging Het
Dst T A 1: 34,191,147 I2785N probably benign Het
Dynap A T 18: 70,241,225 Y77N possibly damaging Het
Eif4g3 T C 4: 138,183,199 L1330P possibly damaging Het
Eif4g3 T A 4: 138,198,097 S1584T probably benign Het
Enpp1 A T 10: 24,679,248 C67S probably null Het
Enpp5 C T 17: 44,081,136 T152I probably damaging Het
Erbb4 T C 1: 68,343,900 M313V probably damaging Het
Erc2 T G 14: 27,776,881 L238R probably damaging Het
Eya3 T A 4: 132,721,387 probably benign Het
Farp1 T C 14: 121,238,787 F339L probably damaging Het
Fsip2 A C 2: 82,975,353 D672A possibly damaging Het
Gap43 G T 16: 42,292,218 P60Q probably benign Het
Gatsl3 A G 11: 4,219,004 E57G possibly damaging Het
Gpr37l1 T A 1: 135,167,045 I154F probably damaging Het
Greb1 A G 12: 16,696,328 S1314P probably damaging Het
Hectd4 A T 5: 121,348,442 M3167L probably benign Het
Hps3 C T 3: 20,030,410 probably null Het
Hps5 A G 7: 46,786,589 C178R probably benign Het
Hspg2 T A 4: 137,570,073 probably benign Het
Impdh2-ps A G 8: 100,031,207 noncoding transcript Het
Josd2 T A 7: 44,471,254 N138K probably damaging Het
Mtmr6 T G 14: 60,292,097 M315R probably damaging Het
Mtrf1 G A 14: 79,413,080 V323M probably damaging Het
Myo16 G T 8: 10,373,527 G288W probably damaging Het
Myo18a T C 11: 77,823,323 Y748H probably damaging Het
Narfl A T 17: 25,781,309 H322L probably damaging Het
Nek1 A T 8: 61,098,511 N853I probably benign Het
Npnt T G 3: 132,904,691 T272P possibly damaging Het
Olfr11 T A 13: 21,639,170 M118L possibly damaging Het
Olfr1390 G A 11: 49,341,321 G263D probably benign Het
Olfr558 T A 7: 102,710,171 I304N probably damaging Het
Olfr668 G A 7: 104,924,810 T318I possibly damaging Het
Olfr694 C A 7: 106,689,144 E196* probably null Het
Olfr76 A G 19: 12,119,870 Y269H possibly damaging Het
Pappa2 T G 1: 158,957,002 D146A probably damaging Het
Pappa2 T C 1: 158,957,012 R143G probably benign Het
Pcsk9 C T 4: 106,447,156 G496R probably damaging Het
Pes1 A G 11: 3,964,058 K8E probably damaging Het
Phlpp2 G A 8: 109,940,420 G1194S probably damaging Het
Pkn1 A C 8: 83,671,749 V763G probably damaging Het
Pkp2 C A 16: 16,230,724 A331E probably damaging Het
Plb1 T A 5: 32,349,679 probably null Het
Plxna1 A T 6: 89,332,675 probably null Het
Polq C T 16: 37,041,747 T264M probably damaging Het
Prkag3 T C 1: 74,740,705 *490W probably null Het
Prl2c1 T C 13: 27,857,678 C228R probably damaging Het
Pus7l T C 15: 94,540,710 S85G probably benign Het
Rfc3 A C 5: 151,644,776 probably benign Het
Riox2 A G 16: 59,489,369 N362S probably benign Het
Rnf219 C T 14: 104,510,383 D43N probably damaging Het
Scaper A T 9: 55,743,648 D904E probably damaging Het
Scn11a T C 9: 119,754,561 M1663V probably benign Het
Slc13a3 A T 2: 165,430,289 I278N possibly damaging Het
Slc22a7 T C 17: 46,434,997 E278G probably damaging Het
Snrnp48 T A 13: 38,209,917 M66K probably damaging Het
Styk1 T G 6: 131,300,466 E404A probably damaging Het
Synj1 T A 16: 90,955,419 H1016L probably benign Het
Tbc1d8 G A 1: 39,402,878 T211I possibly damaging Het
Tjp2 T C 19: 24,120,111 probably null Het
Tmem87a A G 2: 120,360,037 probably null Het
Trappc9 T G 15: 72,937,060 Y718S probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Ugt2a3 C T 5: 87,327,195 G397R probably damaging Het
Wdtc1 G T 4: 133,301,799 N325K possibly damaging Het
Whrn T C 4: 63,418,165 H720R probably damaging Het
Xirp2 A T 2: 67,519,265 D3268V probably damaging Het
Zc3h7a A T 16: 11,141,709 H793Q probably damaging Het
Zfp518b C T 5: 38,674,498 A55T possibly damaging Het
Zmynd8 G A 2: 165,805,329 T901M probably damaging Het
Other mutations in Wdr33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Wdr33 APN 18 31878116 missense probably damaging 1.00
IGL01099:Wdr33 APN 18 31906789 unclassified probably benign
IGL01628:Wdr33 APN 18 31888310 missense unknown
IGL03296:Wdr33 APN 18 31827391 missense probably benign 0.03
R0103:Wdr33 UTSW 18 31833335 missense probably damaging 1.00
R0279:Wdr33 UTSW 18 31888324 missense unknown
R0563:Wdr33 UTSW 18 31886739 missense possibly damaging 0.94
R0730:Wdr33 UTSW 18 31835376 splice site probably benign
R1077:Wdr33 UTSW 18 31835461 missense probably benign 0.03
R1377:Wdr33 UTSW 18 31888641 missense unknown
R1712:Wdr33 UTSW 18 31896631 missense unknown
R1855:Wdr33 UTSW 18 31906856 unclassified probably benign
R2013:Wdr33 UTSW 18 31888976 missense unknown
R2014:Wdr33 UTSW 18 31833599 missense probably damaging 1.00
R4497:Wdr33 UTSW 18 31893079 missense unknown
R4727:Wdr33 UTSW 18 31888447 missense unknown
R4777:Wdr33 UTSW 18 31881248 missense probably damaging 1.00
R4907:Wdr33 UTSW 18 31906993 makesense probably null
R5811:Wdr33 UTSW 18 31902620 missense unknown
R6053:Wdr33 UTSW 18 31878063 missense possibly damaging 0.93
R6454:Wdr33 UTSW 18 31829975 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- ACTTTCCTGGCATGCTTGATG -3'
(R):5'- TCAACCAGCTTGTGAACGCT -3'

Sequencing Primer
(F):5'- CTGTAATTAAAGGCACGGCTACTGC -3'
(R):5'- AAGCCACCATGTGATTGCTG -3'
Posted On2015-11-11