Incidental Mutation 'R0348:Olfm1'
ID35967
Institutional Source Beutler Lab
Gene Symbol Olfm1
Ensembl Gene ENSMUSG00000026833
Gene Nameolfactomedin 1
SynonymsNoelin 1, Pancortin 1-4, Noelin 2
MMRRC Submission 038555-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0348 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location28192992-28230736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 28212542 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 76 (M76K)
Ref Sequence ENSEMBL: ENSMUSP00000097815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028177] [ENSMUST00000100244] [ENSMUST00000102879] [ENSMUST00000113920]
Predicted Effect probably benign
Transcript: ENSMUST00000028177
AA Change: M104K

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000028177
Gene: ENSMUSG00000026833
AA Change: M104K

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Noelin-1 54 153 1.5e-50 PFAM
Blast:OLF 170 215 1e-5 BLAST
OLF 228 478 5.43e-170 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100244
AA Change: M76K

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000097815
Gene: ENSMUSG00000026833
AA Change: M76K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Noelin-1 25 125 2.6e-53 PFAM
Blast:OLF 142 187 1e-5 BLAST
OLF 200 450 5.43e-170 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102879
AA Change: M104K

PolyPhen 2 Score 0.178 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000099943
Gene: ENSMUSG00000026833
AA Change: M104K

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Noelin-1 53 153 4.3e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113920
AA Change: M61K

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000109553
Gene: ENSMUSG00000026833
AA Change: M61K

DomainStartEndE-ValueType
Pfam:Noelin-1 10 110 7.4e-53 PFAM
Blast:OLF 127 172 1e-5 BLAST
OLF 185 435 5.43e-170 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152415
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product shares extensive sequence similarity with the rat neuronal olfactomedin-related ER localized protein. While the exact function of the encoded protein is not known, its abundant expression in brain suggests that it may have an essential role in nerve tissue. Several alternatively spliced transcripts encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display decreased cerebral infarction size and reduced fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik T C 11: 3,894,987 D34G probably benign Het
Adam6a T C 12: 113,544,717 S237P probably damaging Het
Adamts13 A C 2: 26,981,080 D235A probably benign Het
Adgb T A 10: 10,357,879 M1259L probably benign Het
Apbb1 T C 7: 105,565,303 Q529R probably damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Camta1 T C 4: 151,586,431 T96A possibly damaging Het
Ccdc148 A T 2: 59,004,072 probably null Het
Cep170b T C 12: 112,736,806 Y568H probably damaging Het
Clca4b A T 3: 144,921,980 I410N probably damaging Het
Cnot10 G A 9: 114,598,770 T592I probably benign Het
Col6a3 C T 1: 90,828,049 A173T probably damaging Het
Ctcf T A 8: 105,676,157 C560* probably null Het
Daglb G A 5: 143,487,196 V369I probably benign Het
Defb19 G A 2: 152,580,226 L8F unknown Het
Emcn G T 3: 137,372,847 E65* probably null Het
Etl4 G T 2: 20,778,129 R753L probably damaging Het
Fam151b T C 13: 92,450,181 Y248C probably benign Het
Fmo1 T C 1: 162,836,135 D275G probably benign Het
Gjd4 A G 18: 9,280,964 V38A possibly damaging Het
Hivep1 T C 13: 42,158,379 V1365A possibly damaging Het
Hivep2 T C 10: 14,129,958 S767P possibly damaging Het
Hoxa6 T C 6: 52,206,568 T166A possibly damaging Het
Ift80 G T 3: 68,935,899 L367I probably benign Het
Igf2bp1 T C 11: 95,968,893 N369S possibly damaging Het
Igsf11 C A 16: 39,008,817 D24E probably benign Het
Ints5 C T 19: 8,895,750 L358F probably damaging Het
Kbtbd3 A G 9: 4,330,519 T298A possibly damaging Het
Kif28 C A 1: 179,731,253 V297F probably damaging Het
Krt12 T C 11: 99,417,945 Y422C probably damaging Het
Lig1 T A 7: 13,309,197 W856R probably damaging Het
Liph C T 16: 21,967,980 probably null Het
Lrig3 T A 10: 126,013,448 C1012* probably null Het
Lrit1 A G 14: 37,060,225 E285G probably damaging Het
Lrrc31 A G 3: 30,689,228 V196A probably benign Het
Lrrn4 T C 2: 132,870,443 T487A probably benign Het
Mllt10 T C 2: 18,162,613 Y372H probably damaging Het
Mrpl50 A T 4: 49,514,515 V52E probably damaging Het
Mthfd1l T C 10: 4,056,766 V676A probably damaging Het
Ncl C T 1: 86,356,640 D245N possibly damaging Het
Neil1 A T 9: 57,146,781 probably null Het
Nfatc3 A G 8: 106,092,195 E515G probably damaging Het
Nlrp4b A G 7: 10,715,181 E70G possibly damaging Het
Nme3 A T 17: 24,896,517 I2F possibly damaging Het
Nup210 G A 6: 91,074,310 H364Y probably benign Het
Nxpe3 T A 16: 55,866,535 T37S probably benign Het
Pgbd5 A T 8: 124,434,032 V32E probably damaging Het
Plcb4 T C 2: 135,968,419 M646T probably damaging Het
Plekha7 G A 7: 116,158,020 P565L probably damaging Het
Poc5 A G 13: 96,398,866 D213G probably null Het
Poli A G 18: 70,523,381 I125T probably benign Het
Ppm1f T C 16: 16,903,390 M1T probably null Het
Psmd7 T C 8: 107,580,891 K320R unknown Het
Rabggtb A G 3: 153,910,317 V128A probably damaging Het
Rasa2 A T 9: 96,571,959 L308H probably damaging Het
Serpina1d C T 12: 103,763,775 V383M probably benign Het
Sipa1l1 T C 12: 82,384,756 probably null Het
Sos1 T C 17: 80,408,311 T1006A probably benign Het
Sugp1 T A 8: 70,070,008 Y453N probably damaging Het
Taf3 A T 2: 10,042,644 D64E probably benign Het
Tcf19 A T 17: 35,515,904 probably null Het
Trim60 T A 8: 65,001,216 H127L probably damaging Het
Tubb4a C T 17: 57,080,770 V419M probably damaging Het
Vmn2r22 G T 6: 123,637,725 T302K probably damaging Het
Vmn2r68 T G 7: 85,221,676 T800P possibly damaging Het
Zfhx2 A C 14: 55,063,508 V2262G probably damaging Het
Other mutations in Olfm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Olfm1 APN 2 28214703 missense probably damaging 1.00
IGL01326:Olfm1 APN 2 28229552 missense probably damaging 1.00
IGL01358:Olfm1 APN 2 28229495 missense probably damaging 1.00
IGL02076:Olfm1 APN 2 28222625 missense probably damaging 0.99
IGL02337:Olfm1 APN 2 28229685 missense probably damaging 1.00
IGL02693:Olfm1 APN 2 28212650 missense probably damaging 1.00
IGL02825:Olfm1 APN 2 28229078 missense probably damaging 1.00
IGL02974:Olfm1 APN 2 28229689 missense probably damaging 1.00
R0266:Olfm1 UTSW 2 28229607 missense probably damaging 1.00
R0411:Olfm1 UTSW 2 28208211 missense possibly damaging 0.51
R0542:Olfm1 UTSW 2 28214628 missense possibly damaging 0.85
R1252:Olfm1 UTSW 2 28229435 missense probably benign 0.01
R1649:Olfm1 UTSW 2 28229267 missense possibly damaging 0.71
R1696:Olfm1 UTSW 2 28208116 nonsense probably null
R1931:Olfm1 UTSW 2 28222662 splice site probably null
R1986:Olfm1 UTSW 2 28214706 missense probably benign 0.13
R3749:Olfm1 UTSW 2 28208088 missense probably damaging 0.96
R3913:Olfm1 UTSW 2 28208174 missense possibly damaging 0.88
R4927:Olfm1 UTSW 2 28214786 missense probably benign 0.18
R4940:Olfm1 UTSW 2 28222590 missense possibly damaging 0.51
R7033:Olfm1 UTSW 2 28229336 missense probably damaging 1.00
R7059:Olfm1 UTSW 2 28222616 missense probably damaging 1.00
X0018:Olfm1 UTSW 2 28229369 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- AACTGGTAAATCACGCTTGGACCAC -3'
(R):5'- GGCACGGCTTTACAAGACAGAGAAC -3'

Sequencing Primer
(F):5'- TTGGACCACTCGTGGCTC -3'
(R):5'- gagggagagagaaggggag -3'
Posted On2013-05-09