Incidental Mutation 'R3421:Telo2'
ID359681
Institutional Source Beutler Lab
Gene Symbol Telo2
Ensembl Gene ENSMUSG00000024170
Gene Nametelomere maintenance 2
Synonyms1200003M09Rik
MMRRC Submission 040639-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3421 (G1)
Quality Score21
Status Validated
Chromosome17
Chromosomal Location25099570-25115967 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 25110752 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 262 (R262Q)
Ref Sequence ENSEMBL: ENSMUSP00000110835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024987] [ENSMUST00000115181]
Predicted Effect probably damaging
Transcript: ENSMUST00000024987
AA Change: R262Q

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000024987
Gene: ENSMUSG00000024170
AA Change: R262Q

DomainStartEndE-ValueType
Pfam:Telomere_reg-2 513 621 3.8e-38 PFAM
low complexity region 771 782 N/A INTRINSIC
low complexity region 816 837 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115181
AA Change: R262Q

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110835
Gene: ENSMUSG00000024170
AA Change: R262Q

DomainStartEndE-ValueType
Pfam:Telomere_reg-2 513 621 3.8e-38 PFAM
low complexity region 771 782 N/A INTRINSIC
low complexity region 816 837 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139196
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146522
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151205
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156698
Meta Mutation Damage Score 0.324 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions as an S-phase checkpoint protein in the cell cycle. The protein may also play a role in DNA repair.[provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality prior to E13.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T A 5: 114,212,636 probably null Het
Agbl3 A G 6: 34,793,965 T132A probably benign Het
Amn1 A T 6: 149,169,452 L196* probably null Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Armc4 T C 18: 7,223,523 probably benign Het
Atp7b C T 8: 22,028,670 D51N probably damaging Het
Brip1 A T 11: 86,152,669 Y356* probably null Het
Ccdc40 C T 11: 119,234,779 P348L probably benign Het
Chrdl2 G A 7: 100,023,868 C9Y probably damaging Het
Chst4 T C 8: 110,030,406 D192G probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
D930048N14Rik T C 11: 51,654,958 *226R probably null Het
Dmgdh T C 13: 93,711,361 V522A probably benign Het
Dtx2 T A 5: 136,012,478 Y246N probably damaging Het
Fam19a1 C A 6: 96,649,138 D112E probably damaging Het
Gtf2ird1 T A 5: 134,388,500 M518L probably benign Het
Hoxc6 T A 15: 103,010,895 W188R probably damaging Het
Igfn1 C T 1: 135,976,917 probably null Het
Kcnip1 A G 11: 33,645,594 V43A probably damaging Het
Kif4-ps A T 12: 101,146,971 E453V probably damaging Het
Kifap3 T A 1: 163,794,026 I81N probably damaging Het
Mgat4d T C 8: 83,358,143 S172P probably damaging Het
Mr1 T C 1: 155,137,591 Y80C probably damaging Het
Nuak2 A G 1: 132,332,080 D532G probably benign Het
Olfr1230 C G 2: 89,296,553 S239T probably benign Het
Olfr1288 A G 2: 111,478,952 H56R probably benign Het
Olfr20 A G 11: 73,354,634 N294D probably damaging Het
Olfr26 A G 9: 38,855,325 K88E possibly damaging Het
Olfr725 T C 14: 50,034,540 T288A possibly damaging Het
Pik3cg A T 12: 32,204,739 F416L probably damaging Het
Prex1 A G 2: 166,617,854 V124A probably damaging Het
Psmb2 T C 4: 126,677,837 M28T probably damaging Het
Ric1 T C 19: 29,567,590 I230T probably damaging Het
Saysd1 T A 14: 20,082,926 K54N probably benign Het
Slc25a17 C T 15: 81,360,700 V11I probably benign Het
Slc5a4a T C 10: 76,176,573 V359A probably benign Het
Slc7a3 T A X: 101,080,875 probably benign Het
Slco1a5 A T 6: 142,268,238 D52E possibly damaging Het
Soat2 T C 15: 102,156,809 probably benign Het
Zdhhc14 T A 17: 5,753,091 *490R probably null Het
Zfp217 A G 2: 170,120,017 F130S possibly damaging Het
Zfp712 C T 13: 67,052,392 V10M probably damaging Het
Other mutations in Telo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01340:Telo2 APN 17 25100129 splice site probably benign
IGL01398:Telo2 APN 17 25105774 missense probably benign 0.00
IGL01878:Telo2 APN 17 25101358 missense probably benign 0.19
IGL02728:Telo2 APN 17 25104654 missense probably damaging 1.00
R0669:Telo2 UTSW 17 25105823 missense probably benign 0.01
R0671:Telo2 UTSW 17 25113165 missense probably benign 0.00
R1783:Telo2 UTSW 17 25102738 splice site probably null
R1869:Telo2 UTSW 17 25114994 missense probably benign 0.32
R1988:Telo2 UTSW 17 25101668 missense probably benign 0.04
R2018:Telo2 UTSW 17 25105408 missense probably damaging 1.00
R2167:Telo2 UTSW 17 25110818 missense probably benign
R2219:Telo2 UTSW 17 25103699 missense probably benign 0.00
R3880:Telo2 UTSW 17 25106833 missense probably damaging 1.00
R4190:Telo2 UTSW 17 25102013 missense probably benign 0.00
R4299:Telo2 UTSW 17 25115256 missense possibly damaging 0.94
R4574:Telo2 UTSW 17 25101673 missense probably damaging 1.00
R4600:Telo2 UTSW 17 25105148 missense possibly damaging 0.79
R6010:Telo2 UTSW 17 25104878 missense possibly damaging 0.79
R6185:Telo2 UTSW 17 25102040 missense probably benign 0.29
R6513:Telo2 UTSW 17 25101412 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAACAGCCAGCCTGGAAAG -3'
(R):5'- TTACCCATGTCTGTGAACCTGTG -3'

Sequencing Primer
(F):5'- CCTGGAAAGGCAATGGTGAG -3'
(R):5'- CTGTGAACCTGTGGGGCTG -3'
Posted On2015-11-18