Incidental Mutation 'R4066:Dpyd'
ID359731
Institutional Source Beutler Lab
Gene Symbol Dpyd
Ensembl Gene ENSMUSG00000033308
Gene Namedihydropyrimidine dehydrogenase
SynonymsDPD, E330028L06Rik
MMRRC Submission 040973-MU
Accession Numbers

Genbank: NM_170778; MGI: 2139667

Is this an essential gene? Possibly non essential (E-score: 0.329) question?
Stock #R4066 (G1)
Quality Score217
Status Validated
Chromosome3
Chromosomal Location118562129-119432924 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) AAT to AATGTATATATAT at 118897089 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000039429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039177]
Predicted Effect probably benign
Transcript: ENSMUST00000039177
SMART Domains Protein: ENSMUSP00000039429
Gene: ENSMUSG00000033308

DomainStartEndE-ValueType
Pfam:Fer4_20 55 168 4.6e-35 PFAM
Pfam:Pyr_redox_2 188 499 1.5e-15 PFAM
Pfam:NAD_binding_8 193 249 5.5e-8 PFAM
Pfam:DHO_dh 532 838 8.1e-36 PFAM
Pfam:Dus 617 822 7.5e-8 PFAM
Pfam:Fer4_10 945 997 7.4e-9 PFAM
Pfam:Fer4_21 946 1004 1.3e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129148
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pyrimidine catabolic enzyme and the initial and rate-limiting factor in the pathway of uracil and thymidine catabolism. Mutations in this gene result in dihydropyrimidine dehydrogenase deficiency, an error in pyrimidine metabolism associated with thymine-uraciluria and an increased risk of toxicity in cancer patients receiving 5-fluorouracil chemotherapy. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 A T 1: 63,563,425 H582L probably damaging Het
Ankrd13d C T 19: 4,270,360 A118T probably benign Het
Arhgap30 C T 1: 171,408,323 T755I probably benign Het
Cab39l A G 14: 59,547,005 H285R probably benign Het
Dspp T A 5: 104,177,194 N474K unknown Het
Fanci T C 7: 79,412,757 probably null Het
Fras1 T A 5: 96,770,683 I3526K possibly damaging Het
Fut8 T A 12: 77,464,061 Y421N probably damaging Het
Gm12258 C T 11: 58,858,526 L176F probably benign Het
Gm8220 A T 14: 44,285,638 R12* probably null Het
Gm9825 T A 6: 7,983,009 noncoding transcript Het
Hecw1 T C 13: 14,316,431 S659G probably damaging Het
Hnrnpr C A 4: 136,339,346 probably benign Het
Htt C T 5: 34,878,847 T2046I probably benign Het
Kat7 T C 11: 95,284,141 D259G possibly damaging Het
Klra9 T C 6: 130,188,744 T103A probably benign Het
Lad1 A G 1: 135,827,427 E147G probably damaging Het
Lipo2 T C 19: 33,720,859 I373V probably benign Het
Ltb4r1 G T 14: 55,767,495 W85L probably damaging Het
Ltn1 T C 16: 87,416,230 Y481C possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Muc4 A T 16: 32,751,051 I310F possibly damaging Het
Myl10 A G 5: 136,695,450 K70E probably damaging Het
Nptx2 G T 5: 144,556,312 W403L probably damaging Het
Nyap2 A G 1: 81,241,835 Y524C probably damaging Het
Olfr1245 T A 2: 89,575,179 L182F probably damaging Het
Olfr1415 A G 1: 92,491,189 C189R probably damaging Het
Olfr906 T A 9: 38,488,482 M151K probably benign Het
Pde9a A G 17: 31,443,838 *64W probably null Het
Ppp2r5b T C 19: 6,229,330 Y379C probably damaging Het
Rd3l T G 12: 111,979,511 N178T probably benign Het
Recql4 A G 15: 76,705,827 Y766H probably damaging Het
Shcbp1 A G 8: 4,748,716 I401T probably damaging Het
Shd A T 17: 55,971,581 D48V probably damaging Het
Slc14a1 A G 18: 78,111,377 W209R probably damaging Het
Slc2a9 T C 5: 38,483,349 K6E probably benign Het
Slco6d1 A G 1: 98,463,846 probably benign Het
Spic T C 10: 88,675,683 H237R possibly damaging Het
Stau2 A G 1: 16,394,059 S156P possibly damaging Het
Stmn2 T C 3: 8,509,608 probably benign Het
Togaram2 C A 17: 71,716,238 probably benign Het
Trpc5 T A X: 144,419,598 R545* probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Wdfy3 C T 5: 101,922,447 V1152I probably benign Het
Xpo4 G T 14: 57,588,054 H939N probably benign Het
Other mutations in Dpyd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Dpyd APN 3 118944242 missense probably damaging 1.00
IGL00508:Dpyd APN 3 119064987 missense probably benign 0.06
IGL02113:Dpyd APN 3 118999219 missense probably benign 0.06
IGL02177:Dpyd APN 3 119064910 missense possibly damaging 0.76
IGL03001:Dpyd APN 3 118917242 missense probably benign 0.07
IGL03106:Dpyd APN 3 119195134 missense probably benign 0.03
IGL03399:Dpyd APN 3 119314777 missense probably damaging 0.98
F5770:Dpyd UTSW 3 118897126 nonsense probably null
F6893:Dpyd UTSW 3 118804134 critical splice donor site probably null
R0014:Dpyd UTSW 3 119141935 missense probably damaging 1.00
R0081:Dpyd UTSW 3 118944255 missense probably benign 0.00
R0267:Dpyd UTSW 3 118917272 missense probably benign
R0349:Dpyd UTSW 3 118917099 nonsense probably null
R0387:Dpyd UTSW 3 119427226 missense probably benign 0.21
R0523:Dpyd UTSW 3 118899203 missense probably benign
R0555:Dpyd UTSW 3 119431542 missense probably damaging 1.00
R0652:Dpyd UTSW 3 119427275 missense probably damaging 1.00
R0741:Dpyd UTSW 3 118674505 missense possibly damaging 0.79
R1313:Dpyd UTSW 3 118899161 splice acceptor site probably benign
R1554:Dpyd UTSW 3 119065046 splice site probably null
R1610:Dpyd UTSW 3 119065006 missense probably benign
R1710:Dpyd UTSW 3 118610443 critical splice acceptor site probably null
R1861:Dpyd UTSW 3 118917131 missense probably damaging 1.00
R2103:Dpyd UTSW 3 119064952 missense probably benign 0.02
R2130:Dpyd UTSW 3 118674568 missense probably benign
R2131:Dpyd UTSW 3 118674568 missense probably benign
R2882:Dpyd UTSW 3 119065030 missense probably damaging 0.99
R3771:Dpyd UTSW 3 119412278 critical splice donor site probably null
R3978:Dpyd UTSW 3 118897088 critical splice acceptor site probably benign
R3978:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4030:Dpyd UTSW 3 118897166 missense probably benign 0.03
R4065:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4234:Dpyd UTSW 3 119431584 missense probably damaging 1.00
R4502:Dpyd UTSW 3 118797537 missense probably damaging 1.00
R4638:Dpyd UTSW 3 119266077 missense probably benign 0.03
R4980:Dpyd UTSW 3 118917118 missense probably damaging 0.99
R5262:Dpyd UTSW 3 118797422 nonsense probably null
R5348:Dpyd UTSW 3 118781943 missense probably benign
R5587:Dpyd UTSW 3 119064951 missense probably damaging 1.00
R5611:Dpyd UTSW 3 119194293 missense probably benign
R5665:Dpyd UTSW 3 118917092 missense probably damaging 1.00
R5716:Dpyd UTSW 3 118899179 missense probably damaging 1.00
R5786:Dpyd UTSW 3 119427237 missense probably damaging 0.97
R6046:Dpyd UTSW 3 119431575 missense probably benign 0.01
R6404:Dpyd UTSW 3 119265957 missense probably benign 0.02
R6703:Dpyd UTSW 3 118897200 splice site probably null
V7581:Dpyd UTSW 3 118897126 nonsense probably null
V7582:Dpyd UTSW 3 118897126 nonsense probably null
V7583:Dpyd UTSW 3 118897126 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAGATCTGTTAGATTGTTCAGAGC -3'
(R):5'- CCAGATAAGCTATGAATGATGTCTTAC -3'

Sequencing Primer
(F):5'- CAGCTTGAATCTGTGGAAGCC -3'
(R):5'- CTGCTTTTGGCGACAAGT -3'
Posted OnDec 11, 2015