Incidental Mutation 'R4050:Ovgp1'
ID359751
Institutional Source Beutler Lab
Gene Symbol Ovgp1
Ensembl Gene ENSMUSG00000074340
Gene Nameoviductal glycoprotein 1
SynonymsChit5, MOGP, muc9, mucin 9, OGP, oviductin
MMRRC Submission 040968-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4050 (G1)
Quality Score78
Status Validated
Chromosome3
Chromosomal Location105973711-105987423 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 105986596 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000573] [ENSMUST00000163626]
Predicted Effect unknown
Transcript: ENSMUST00000000573
AA Change: I562V
SMART Domains Protein: ENSMUSP00000000573
Gene: ENSMUSG00000074340
AA Change: I562V

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Glyco_18 22 360 1.38e-134 SMART
low complexity region 486 515 N/A INTRINSIC
low complexity region 533 626 N/A INTRINSIC
low complexity region 637 648 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000092878
Predicted Effect probably benign
Transcript: ENSMUST00000163626
SMART Domains Protein: ENSMUSP00000132424
Gene: ENSMUSG00000074340

DomainStartEndE-ValueType
Glyco_18 9 226 8.52e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167642
Meta Mutation Damage Score 0.0532 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large, carbohydrate-rich, epithelial glycoprotein with numerous O-glycosylation sites located within threonine, serine, and proline-rich tandem repeats. The gene is similar to members of the mucin and the glycosyl hydrolase 18 gene families. Regulation of expression may be estrogen-dependent. Gene expression and protein secretion occur during late follicular development through early cleavage-stage embryonic development. The protein is secreted from non-ciliated oviductal epithelial cells and associates with ovulated oocytes, blastomeres, and spermatozoan acrosomal regions. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene show no phenotypic abnormalities. Female reproduction is essentially normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik A G 4: 147,944,992 D473G probably damaging Het
9530053A07Rik T C 7: 28,152,985 V1311A possibly damaging Het
Abca1 T A 4: 53,044,144 Q1826L probably damaging Het
Apob G A 12: 8,015,390 V4087I probably benign Het
Atp10b G A 11: 43,259,536 A1354T probably benign Het
Baz1a A G 12: 54,929,619 V424A probably benign Het
Cdc20b G A 13: 113,064,285 D180N probably benign Het
Cep57l1 G T 10: 41,729,360 R130S probably damaging Het
Ddb1 A G 19: 10,627,807 D1053G probably benign Het
Ddx39 T A 8: 83,722,234 M246K probably benign Het
Dip2a G A 10: 76,278,607 T1013M probably damaging Het
Edar G T 10: 58,609,947 T265N possibly damaging Het
Fam207a T C 10: 77,514,330 R75G possibly damaging Het
Fam208b A G 13: 3,573,507 S2148P probably benign Het
Gbp8 T A 5: 105,031,238 I132F probably damaging Het
Gga1 A G 15: 78,891,491 D382G probably benign Het
Ggps1 T C 13: 14,053,699 K300E probably benign Het
Gm10518 C A 1: 179,803,813 probably benign Het
Gm13078 T C 4: 143,727,122 S267P probably benign Het
Gm8074 G A 9: 78,322,336 noncoding transcript Het
H2-Eb1 T A 17: 34,314,368 L188Q probably damaging Het
Heatr6 A G 11: 83,755,773 S95G probably damaging Het
Hnf1a T A 5: 114,970,574 N91Y probably damaging Het
Ints10 C T 8: 68,827,351 S710F probably damaging Het
Kazn C T 4: 142,106,904 E614K unknown Het
Kif26a T A 12: 112,179,916 M1812K probably benign Het
Lmo7 A T 14: 101,902,277 K488* probably null Het
Mad1l1 A G 5: 140,132,816 S457P probably damaging Het
Met A G 6: 17,533,984 T645A probably benign Het
Mpp4 T C 1: 59,146,744 probably null Het
Mycl A T 4: 122,996,839 probably null Het
Ncbp1 G A 4: 46,147,483 R110H probably damaging Het
Nfasc G T 1: 132,610,305 probably benign Het
Nup35 A G 2: 80,655,976 I212V probably benign Het
Olfr1181 A G 2: 88,423,623 M134T probably damaging Het
Olfr1373 T G 11: 52,145,134 Y132S probably damaging Het
Pcgf5 G A 19: 36,442,911 S181N probably damaging Het
Plk2 C T 13: 110,399,866 T617I probably damaging Het
Polq A T 16: 37,092,820 probably null Het
Ppp1r1a A G 15: 103,532,454 L92P probably damaging Het
Prg4 G C 1: 150,454,759 probably benign Het
Prune1 T C 3: 95,262,231 K220R possibly damaging Het
Rab3gap2 G A 1: 185,272,643 probably null Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sall3 G A 18: 80,971,482 A1005V probably benign Het
Samd15 T G 12: 87,200,632 N30K probably benign Het
Scn8a A T 15: 101,013,413 K905* probably null Het
Scrib G A 15: 76,051,473 R1245W possibly damaging Het
Skint4 C T 4: 112,124,614 S260L probably benign Het
Slc29a2 A T 19: 5,029,453 M339L possibly damaging Het
Spire1 G T 18: 67,529,031 probably null Het
Synpo2 T C 3: 123,114,278 D463G possibly damaging Het
Taf4 C A 2: 179,932,012 G688C probably damaging Het
Tpte T A 8: 22,365,984 V600E probably damaging Het
Ttn A G 2: 76,821,166 V10953A probably benign Het
Vav2 T C 2: 27,288,679 Y333C probably benign Het
Vav2 A G 2: 27,291,403 S311P probably damaging Het
Zbtb26 A C 2: 37,436,988 M1R probably null Het
Zfp26 G A 9: 20,442,229 P88L probably benign Het
Zfp324 T C 7: 12,970,867 F328L probably damaging Het
Other mutations in Ovgp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Ovgp1 APN 3 105981277 nonsense probably null
IGL01152:Ovgp1 APN 3 105986172 missense possibly damaging 0.94
IGL01458:Ovgp1 APN 3 105974991 missense probably benign 0.01
IGL01646:Ovgp1 APN 3 105978349 missense probably damaging 1.00
IGL01768:Ovgp1 APN 3 105981351 critical splice donor site probably null
IGL02712:Ovgp1 APN 3 105986513 unclassified probably benign
IGL03065:Ovgp1 APN 3 105986366 missense probably benign 0.01
IGL03140:Ovgp1 APN 3 105979906 missense probably damaging 1.00
IGL03272:Ovgp1 APN 3 105981325 missense probably damaging 0.99
PIT4472001:Ovgp1 UTSW 3 105986990 missense unknown
R0277:Ovgp1 UTSW 3 105979892 intron probably benign
R0560:Ovgp1 UTSW 3 105986410 unclassified probably benign
R0718:Ovgp1 UTSW 3 105974830 splice site probably benign
R0743:Ovgp1 UTSW 3 105974932 missense probably damaging 1.00
R1362:Ovgp1 UTSW 3 105986575 unclassified probably benign
R1556:Ovgp1 UTSW 3 105986752 unclassified probably benign
R1776:Ovgp1 UTSW 3 105977798 missense possibly damaging 0.52
R1831:Ovgp1 UTSW 3 105985068 missense probably benign 0.04
R1986:Ovgp1 UTSW 3 105974935 missense probably damaging 1.00
R2004:Ovgp1 UTSW 3 105986993 unclassified probably benign
R2156:Ovgp1 UTSW 3 105977717 missense possibly damaging 0.49
R2254:Ovgp1 UTSW 3 105986912 unclassified probably benign
R2860:Ovgp1 UTSW 3 105986567 unclassified probably benign
R2861:Ovgp1 UTSW 3 105986567 unclassified probably benign
R3117:Ovgp1 UTSW 3 105986452 unclassified probably benign
R3793:Ovgp1 UTSW 3 105980171 missense probably benign 0.03
R3835:Ovgp1 UTSW 3 105986315 missense probably benign 0.00
R3894:Ovgp1 UTSW 3 105986567 unclassified probably benign
R3894:Ovgp1 UTSW 3 105986596 unclassified probably benign
R3895:Ovgp1 UTSW 3 105986596 unclassified probably benign
R4050:Ovgp1 UTSW 3 105986567 unclassified probably benign
R4467:Ovgp1 UTSW 3 105977711 missense probably benign 0.04
R4611:Ovgp1 UTSW 3 105986567 unclassified probably benign
R4628:Ovgp1 UTSW 3 105980323 intron probably null
R4738:Ovgp1 UTSW 3 105979918 missense probably damaging 1.00
R4944:Ovgp1 UTSW 3 105979953 missense possibly damaging 0.66
R5110:Ovgp1 UTSW 3 105977783 missense probably damaging 1.00
R6531:Ovgp1 UTSW 3 105987071 unclassified probably benign
R6540:Ovgp1 UTSW 3 105986581 nonsense probably null
R6562:Ovgp1 UTSW 3 105980273 missense probably damaging 1.00
R6601:Ovgp1 UTSW 3 105986431 unclassified probably benign
R6906:Ovgp1 UTSW 3 105986873 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CTGGGATCTCTAAGACCACCAC -3'
(R):5'- CCCAGGGGTGGTCTTAGAAATC -3'

Sequencing Primer
(F):5'- CTGGGGTTTCTAAGACCACAACTG -3'
(R):5'- CCCAGGGGTAGTCTTAGAAATTCC -3'
Posted On2015-12-17