Incidental Mutation 'R0348:Ctcf'
ID35996
Institutional Source Beutler Lab
Gene Symbol Ctcf
Ensembl Gene ENSMUSG00000005698
Gene NameCCCTC-binding factor
Synonyms
MMRRC Submission 038555-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0348 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location105636568-105682922 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 105676157 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 560 (C560*)
Ref Sequence ENSEMBL: ENSMUSP00000005841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005841]
Predicted Effect probably null
Transcript: ENSMUST00000005841
AA Change: C560*
SMART Domains Protein: ENSMUSP00000005841
Gene: ENSMUSG00000005698
AA Change: C560*

DomainStartEndE-ValueType
low complexity region 116 131 N/A INTRINSIC
low complexity region 202 211 N/A INTRINSIC
low complexity region 250 264 N/A INTRINSIC
ZnF_C2H2 266 288 1.22e-4 SMART
ZnF_C2H2 294 316 7.26e-3 SMART
ZnF_C2H2 322 345 6.88e-4 SMART
ZnF_C2H2 351 373 5.14e-3 SMART
ZnF_C2H2 379 401 2.09e-3 SMART
ZnF_C2H2 407 430 2.02e-1 SMART
ZnF_C2H2 437 460 9.44e-2 SMART
ZnF_C2H2 467 489 7.67e-2 SMART
ZnF_C2H2 495 517 3.34e-2 SMART
ZnF_C2H2 523 546 2.53e-2 SMART
ZnF_C2H2 555 575 1.23e1 SMART
low complexity region 592 657 N/A INTRINSIC
low complexity region 700 720 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132679
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137735
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156436
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the BORIS + CTCF gene family and encodes a transcriptional regulator protein with 11 highly conserved zinc finger (ZF) domains. This nuclear protein is able to use different combinations of the ZF domains to bind different DNA target sequences and proteins. Depending upon the context of the site, the protein can bind a histone acetyltransferase (HAT)-containing complex and function as a transcriptional activator or bind a histone deacetylase (HDAC)-containing complex and function as a transcriptional repressor. If the protein is bound to a transcriptional insulator element, it can block communication between enhancers and upstream promoters, thereby regulating imprinted expression. Mutations in this gene have been associated with invasive breast cancers, prostate cancers, and Wilms' tumors. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a null allele die prior at implantation. Mice homozygous for a conditional allele activated in T cells exhibit a defect in the transition from immature single positive T cells to double positive T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik T C 11: 3,894,987 D34G probably benign Het
Adam6a T C 12: 113,544,717 S237P probably damaging Het
Adamts13 A C 2: 26,981,080 D235A probably benign Het
Adgb T A 10: 10,357,879 M1259L probably benign Het
Apbb1 T C 7: 105,565,303 Q529R probably damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Camta1 T C 4: 151,586,431 T96A possibly damaging Het
Ccdc148 A T 2: 59,004,072 probably null Het
Cep170b T C 12: 112,736,806 Y568H probably damaging Het
Clca4b A T 3: 144,921,980 I410N probably damaging Het
Cnot10 G A 9: 114,598,770 T592I probably benign Het
Col6a3 C T 1: 90,828,049 A173T probably damaging Het
Daglb G A 5: 143,487,196 V369I probably benign Het
Defb19 G A 2: 152,580,226 L8F unknown Het
Emcn G T 3: 137,372,847 E65* probably null Het
Etl4 G T 2: 20,778,129 R753L probably damaging Het
Fam151b T C 13: 92,450,181 Y248C probably benign Het
Fmo1 T C 1: 162,836,135 D275G probably benign Het
Gjd4 A G 18: 9,280,964 V38A possibly damaging Het
Hivep1 T C 13: 42,158,379 V1365A possibly damaging Het
Hivep2 T C 10: 14,129,958 S767P possibly damaging Het
Hoxa6 T C 6: 52,206,568 T166A possibly damaging Het
Ift80 G T 3: 68,935,899 L367I probably benign Het
Igf2bp1 T C 11: 95,968,893 N369S possibly damaging Het
Igsf11 C A 16: 39,008,817 D24E probably benign Het
Ints5 C T 19: 8,895,750 L358F probably damaging Het
Kbtbd3 A G 9: 4,330,519 T298A possibly damaging Het
Kif28 C A 1: 179,731,253 V297F probably damaging Het
Krt12 T C 11: 99,417,945 Y422C probably damaging Het
Lig1 T A 7: 13,309,197 W856R probably damaging Het
Liph C T 16: 21,967,980 probably null Het
Lrig3 T A 10: 126,013,448 C1012* probably null Het
Lrit1 A G 14: 37,060,225 E285G probably damaging Het
Lrrc31 A G 3: 30,689,228 V196A probably benign Het
Lrrn4 T C 2: 132,870,443 T487A probably benign Het
Mllt10 T C 2: 18,162,613 Y372H probably damaging Het
Mrpl50 A T 4: 49,514,515 V52E probably damaging Het
Mthfd1l T C 10: 4,056,766 V676A probably damaging Het
Ncl C T 1: 86,356,640 D245N possibly damaging Het
Neil1 A T 9: 57,146,781 probably null Het
Nfatc3 A G 8: 106,092,195 E515G probably damaging Het
Nlrp4b A G 7: 10,715,181 E70G possibly damaging Het
Nme3 A T 17: 24,896,517 I2F possibly damaging Het
Nup210 G A 6: 91,074,310 H364Y probably benign Het
Nxpe3 T A 16: 55,866,535 T37S probably benign Het
Olfm1 T A 2: 28,212,542 M76K probably benign Het
Pgbd5 A T 8: 124,434,032 V32E probably damaging Het
Plcb4 T C 2: 135,968,419 M646T probably damaging Het
Plekha7 G A 7: 116,158,020 P565L probably damaging Het
Poc5 A G 13: 96,398,866 D213G probably null Het
Poli A G 18: 70,523,381 I125T probably benign Het
Ppm1f T C 16: 16,903,390 M1T probably null Het
Psmd7 T C 8: 107,580,891 K320R unknown Het
Rabggtb A G 3: 153,910,317 V128A probably damaging Het
Rasa2 A T 9: 96,571,959 L308H probably damaging Het
Serpina1d C T 12: 103,763,775 V383M probably benign Het
Sipa1l1 T C 12: 82,384,756 probably null Het
Sos1 T C 17: 80,408,311 T1006A probably benign Het
Sugp1 T A 8: 70,070,008 Y453N probably damaging Het
Taf3 A T 2: 10,042,644 D64E probably benign Het
Tcf19 A T 17: 35,515,904 probably null Het
Trim60 T A 8: 65,001,216 H127L probably damaging Het
Tubb4a C T 17: 57,080,770 V419M probably damaging Het
Vmn2r22 G T 6: 123,637,725 T302K probably damaging Het
Vmn2r68 T G 7: 85,221,676 T800P possibly damaging Het
Zfhx2 A C 14: 55,063,508 V2262G probably damaging Het
Other mutations in Ctcf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Ctcf APN 8 105677336 missense unknown
IGL01068:Ctcf APN 8 105681485 unclassified probably benign
IGL01936:Ctcf APN 8 105670232 missense probably benign 0.21
IGL02010:Ctcf APN 8 105664965 missense probably damaging 1.00
IGL02545:Ctcf APN 8 105664381 missense probably benign 0.39
IGL02617:Ctcf APN 8 105677210 splice site probably benign
R0255:Ctcf UTSW 8 105664039 missense possibly damaging 0.76
R0497:Ctcf UTSW 8 105675040 splice site probably benign
R1238:Ctcf UTSW 8 105671277 splice site probably benign
R1903:Ctcf UTSW 8 105675988 splice site probably null
R2508:Ctcf UTSW 8 105671384 missense probably damaging 1.00
R4035:Ctcf UTSW 8 105664157 missense possibly damaging 0.52
R4448:Ctcf UTSW 8 105680293 intron probably benign
R5106:Ctcf UTSW 8 105681498 unclassified probably benign
R6370:Ctcf UTSW 8 105664220 missense probably benign 0.05
R6378:Ctcf UTSW 8 105663791 missense possibly damaging 0.70
R6392:Ctcf UTSW 8 105664133 missense probably damaging 0.97
R6737:Ctcf UTSW 8 105664508 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGATCATGCACAAGCGCACTCA -3'
(R):5'- CAATCCACGCAAGGAAATGCCTTTT -3'

Sequencing Primer
(F):5'- AAGCGCACTCACACGGG -3'
(R):5'- ctccccaacccacccac -3'
Posted On2013-05-09