Incidental Mutation 'R0348:Igf2bp1'
ID36011
Institutional Source Beutler Lab
Gene Symbol Igf2bp1
Ensembl Gene ENSMUSG00000013415
Gene Nameinsulin-like growth factor 2 mRNA binding protein 1
SynonymsIMP-1, Zbp1, D030026A21Rik, D11Moh45, CRD-BP, D11Moh40e, Crdbp
MMRRC Submission 038555-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R0348 (G1)
Quality Score180
Status Not validated
Chromosome11
Chromosomal Location95957163-96005940 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95968893 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 369 (N369S)
Ref Sequence ENSEMBL: ENSMUSP00000013559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013559]
Predicted Effect possibly damaging
Transcript: ENSMUST00000013559
AA Change: N369S

PolyPhen 2 Score 0.586 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000013559
Gene: ENSMUSG00000013415
AA Change: N369S

DomainStartEndE-ValueType
RRM 3 71 7.42e-9 SMART
RRM 82 152 5.25e-9 SMART
KH 194 265 7.75e-14 SMART
KH 275 348 7.34e-15 SMART
low complexity region 377 390 N/A INTRINSIC
KH 404 475 1.91e-13 SMART
KH 486 558 1.42e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138513
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152896
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the insulin-like growth factor 2 mRNA-binding protein family. The protein encoded by this gene contains four K homology domains and two RNA recognition motifs. It functions by binding to the mRNAs of certain genes, including insulin-like growth factor 2, beta-actin and beta-transducin repeat-containing protein, and regulating their translation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous mutation of this locus results in increased neonatal lethality, growth retardation, and impaired intestinal development. Males exhibit increased anxiety-like response and decreased exploratory behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik T C 11: 3,894,987 D34G probably benign Het
Adam6a T C 12: 113,544,717 S237P probably damaging Het
Adamts13 A C 2: 26,981,080 D235A probably benign Het
Adgb T A 10: 10,357,879 M1259L probably benign Het
Apbb1 T C 7: 105,565,303 Q529R probably damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Camta1 T C 4: 151,586,431 T96A possibly damaging Het
Ccdc148 A T 2: 59,004,072 probably null Het
Cep170b T C 12: 112,736,806 Y568H probably damaging Het
Clca4b A T 3: 144,921,980 I410N probably damaging Het
Cnot10 G A 9: 114,598,770 T592I probably benign Het
Col6a3 C T 1: 90,828,049 A173T probably damaging Het
Ctcf T A 8: 105,676,157 C560* probably null Het
Daglb G A 5: 143,487,196 V369I probably benign Het
Defb19 G A 2: 152,580,226 L8F unknown Het
Emcn G T 3: 137,372,847 E65* probably null Het
Etl4 G T 2: 20,778,129 R753L probably damaging Het
Fam151b T C 13: 92,450,181 Y248C probably benign Het
Fmo1 T C 1: 162,836,135 D275G probably benign Het
Gjd4 A G 18: 9,280,964 V38A possibly damaging Het
Hivep1 T C 13: 42,158,379 V1365A possibly damaging Het
Hivep2 T C 10: 14,129,958 S767P possibly damaging Het
Hoxa6 T C 6: 52,206,568 T166A possibly damaging Het
Ift80 G T 3: 68,935,899 L367I probably benign Het
Igsf11 C A 16: 39,008,817 D24E probably benign Het
Ints5 C T 19: 8,895,750 L358F probably damaging Het
Kbtbd3 A G 9: 4,330,519 T298A possibly damaging Het
Kif28 C A 1: 179,731,253 V297F probably damaging Het
Krt12 T C 11: 99,417,945 Y422C probably damaging Het
Lig1 T A 7: 13,309,197 W856R probably damaging Het
Liph C T 16: 21,967,980 probably null Het
Lrig3 T A 10: 126,013,448 C1012* probably null Het
Lrit1 A G 14: 37,060,225 E285G probably damaging Het
Lrrc31 A G 3: 30,689,228 V196A probably benign Het
Lrrn4 T C 2: 132,870,443 T487A probably benign Het
Mllt10 T C 2: 18,162,613 Y372H probably damaging Het
Mrpl50 A T 4: 49,514,515 V52E probably damaging Het
Mthfd1l T C 10: 4,056,766 V676A probably damaging Het
Ncl C T 1: 86,356,640 D245N possibly damaging Het
Neil1 A T 9: 57,146,781 probably null Het
Nfatc3 A G 8: 106,092,195 E515G probably damaging Het
Nlrp4b A G 7: 10,715,181 E70G possibly damaging Het
Nme3 A T 17: 24,896,517 I2F possibly damaging Het
Nup210 G A 6: 91,074,310 H364Y probably benign Het
Nxpe3 T A 16: 55,866,535 T37S probably benign Het
Olfm1 T A 2: 28,212,542 M76K probably benign Het
Pgbd5 A T 8: 124,434,032 V32E probably damaging Het
Plcb4 T C 2: 135,968,419 M646T probably damaging Het
Plekha7 G A 7: 116,158,020 P565L probably damaging Het
Poc5 A G 13: 96,398,866 D213G probably null Het
Poli A G 18: 70,523,381 I125T probably benign Het
Ppm1f T C 16: 16,903,390 M1T probably null Het
Psmd7 T C 8: 107,580,891 K320R unknown Het
Rabggtb A G 3: 153,910,317 V128A probably damaging Het
Rasa2 A T 9: 96,571,959 L308H probably damaging Het
Serpina1d C T 12: 103,763,775 V383M probably benign Het
Sipa1l1 T C 12: 82,384,756 probably null Het
Sos1 T C 17: 80,408,311 T1006A probably benign Het
Sugp1 T A 8: 70,070,008 Y453N probably damaging Het
Taf3 A T 2: 10,042,644 D64E probably benign Het
Tcf19 A T 17: 35,515,904 probably null Het
Trim60 T A 8: 65,001,216 H127L probably damaging Het
Tubb4a C T 17: 57,080,770 V419M probably damaging Het
Vmn2r22 G T 6: 123,637,725 T302K probably damaging Het
Vmn2r68 T G 7: 85,221,676 T800P possibly damaging Het
Zfhx2 A C 14: 55,063,508 V2262G probably damaging Het
Other mutations in Igf2bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02554:Igf2bp1 APN 11 95974168 missense probably damaging 0.97
IGL03263:Igf2bp1 APN 11 95966673 missense probably damaging 1.00
R0011:Igf2bp1 UTSW 11 96005584 missense probably damaging 0.96
R0011:Igf2bp1 UTSW 11 96005584 missense probably damaging 0.96
R0098:Igf2bp1 UTSW 11 95973163 missense probably damaging 1.00
R0534:Igf2bp1 UTSW 11 95966796 splice site probably benign
R2025:Igf2bp1 UTSW 11 95974170 missense possibly damaging 0.95
R2026:Igf2bp1 UTSW 11 95974170 missense possibly damaging 0.95
R2103:Igf2bp1 UTSW 11 95975296 missense probably damaging 0.96
R2104:Igf2bp1 UTSW 11 95975296 missense probably damaging 0.96
R5021:Igf2bp1 UTSW 11 95974006 missense probably damaging 0.98
R5154:Igf2bp1 UTSW 11 95963547 nonsense probably null
R6123:Igf2bp1 UTSW 11 95975296 missense probably damaging 0.96
R6130:Igf2bp1 UTSW 11 95974020 missense probably damaging 1.00
R6736:Igf2bp1 UTSW 11 95973122 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- AGCCTCCAAAAGTAACAGGTGCAG -3'
(R):5'- AGACATGGCTTTTACCAAGCCTGG -3'

Sequencing Primer
(F):5'- CTATAGGAGGACGCCATGAACTC -3'
(R):5'- cctggagtttggtgggtg -3'
Posted On2013-05-09