Incidental Mutation 'R0348:Hivep1'
ID36017
Institutional Source Beutler Lab
Gene Symbol Hivep1
Ensembl Gene ENSMUSG00000021366
Gene Namehuman immunodeficiency virus type I enhancer binding protein 1
SynonymsCryabp1, alphaA-CRYBP1
MMRRC Submission 038555-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.480) question?
Stock #R0348 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location42052021-42192537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42158379 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1365 (V1365A)
Ref Sequence ENSEMBL: ENSMUSP00000056147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060148] [ENSMUST00000220525]
Predicted Effect possibly damaging
Transcript: ENSMUST00000060148
AA Change: V1365A

PolyPhen 2 Score 0.654 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000056147
Gene: ENSMUSG00000021366
AA Change: V1365A

DomainStartEndE-ValueType
coiled coil region 10 36 N/A INTRINSIC
low complexity region 177 194 N/A INTRINSIC
low complexity region 355 371 N/A INTRINSIC
low complexity region 376 388 N/A INTRINSIC
ZnF_C2H2 407 429 4.79e-3 SMART
ZnF_C2H2 435 457 1.95e-3 SMART
low complexity region 488 504 N/A INTRINSIC
low complexity region 595 609 N/A INTRINSIC
low complexity region 844 854 N/A INTRINSIC
ZnF_C2H2 953 980 1.53e2 SMART
low complexity region 1253 1271 N/A INTRINSIC
low complexity region 1275 1307 N/A INTRINSIC
low complexity region 1585 1608 N/A INTRINSIC
low complexity region 1902 1912 N/A INTRINSIC
ZnF_C2H2 2074 2096 2.24e-3 SMART
ZnF_C2H2 2102 2126 1.5e-4 SMART
low complexity region 2164 2183 N/A INTRINSIC
low complexity region 2299 2313 N/A INTRINSIC
low complexity region 2345 2365 N/A INTRINSIC
low complexity region 2517 2527 N/A INTRINSIC
low complexity region 2580 2594 N/A INTRINSIC
low complexity region 2629 2642 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222491
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor belonging to the ZAS family, members of which are large proteins that contain a ZAS domain - a modular protein structure consisting of a pair of C2H2 zinc fingers with an acidic-rich region and a serine/threonine-rich sequence. These proteins bind specifically to the DNA sequence motif, GGGACTTTCC, found in the enhancer elements of several viral promoters, including human immunodeficiency virus (HIV), and to related sequences found in the enhancer elements of a number of cellular promoters. This protein binds to this sequence motif, suggesting a role in the transcriptional regulation of both viral and cellular genes. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik T C 11: 3,894,987 D34G probably benign Het
Adam6a T C 12: 113,544,717 S237P probably damaging Het
Adamts13 A C 2: 26,981,080 D235A probably benign Het
Adgb T A 10: 10,357,879 M1259L probably benign Het
Apbb1 T C 7: 105,565,303 Q529R probably damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Camta1 T C 4: 151,586,431 T96A possibly damaging Het
Ccdc148 A T 2: 59,004,072 probably null Het
Cep170b T C 12: 112,736,806 Y568H probably damaging Het
Clca4b A T 3: 144,921,980 I410N probably damaging Het
Cnot10 G A 9: 114,598,770 T592I probably benign Het
Col6a3 C T 1: 90,828,049 A173T probably damaging Het
Ctcf T A 8: 105,676,157 C560* probably null Het
Daglb G A 5: 143,487,196 V369I probably benign Het
Defb19 G A 2: 152,580,226 L8F unknown Het
Emcn G T 3: 137,372,847 E65* probably null Het
Etl4 G T 2: 20,778,129 R753L probably damaging Het
Fam151b T C 13: 92,450,181 Y248C probably benign Het
Fmo1 T C 1: 162,836,135 D275G probably benign Het
Gjd4 A G 18: 9,280,964 V38A possibly damaging Het
Hivep2 T C 10: 14,129,958 S767P possibly damaging Het
Hoxa6 T C 6: 52,206,568 T166A possibly damaging Het
Ift80 G T 3: 68,935,899 L367I probably benign Het
Igf2bp1 T C 11: 95,968,893 N369S possibly damaging Het
Igsf11 C A 16: 39,008,817 D24E probably benign Het
Ints5 C T 19: 8,895,750 L358F probably damaging Het
Kbtbd3 A G 9: 4,330,519 T298A possibly damaging Het
Kif28 C A 1: 179,731,253 V297F probably damaging Het
Krt12 T C 11: 99,417,945 Y422C probably damaging Het
Lig1 T A 7: 13,309,197 W856R probably damaging Het
Liph C T 16: 21,967,980 probably null Het
Lrig3 T A 10: 126,013,448 C1012* probably null Het
Lrit1 A G 14: 37,060,225 E285G probably damaging Het
Lrrc31 A G 3: 30,689,228 V196A probably benign Het
Lrrn4 T C 2: 132,870,443 T487A probably benign Het
Mllt10 T C 2: 18,162,613 Y372H probably damaging Het
Mrpl50 A T 4: 49,514,515 V52E probably damaging Het
Mthfd1l T C 10: 4,056,766 V676A probably damaging Het
Ncl C T 1: 86,356,640 D245N possibly damaging Het
Neil1 A T 9: 57,146,781 probably null Het
Nfatc3 A G 8: 106,092,195 E515G probably damaging Het
Nlrp4b A G 7: 10,715,181 E70G possibly damaging Het
Nme3 A T 17: 24,896,517 I2F possibly damaging Het
Nup210 G A 6: 91,074,310 H364Y probably benign Het
Nxpe3 T A 16: 55,866,535 T37S probably benign Het
Olfm1 T A 2: 28,212,542 M76K probably benign Het
Pgbd5 A T 8: 124,434,032 V32E probably damaging Het
Plcb4 T C 2: 135,968,419 M646T probably damaging Het
Plekha7 G A 7: 116,158,020 P565L probably damaging Het
Poc5 A G 13: 96,398,866 D213G probably null Het
Poli A G 18: 70,523,381 I125T probably benign Het
Ppm1f T C 16: 16,903,390 M1T probably null Het
Psmd7 T C 8: 107,580,891 K320R unknown Het
Rabggtb A G 3: 153,910,317 V128A probably damaging Het
Rasa2 A T 9: 96,571,959 L308H probably damaging Het
Serpina1d C T 12: 103,763,775 V383M probably benign Het
Sipa1l1 T C 12: 82,384,756 probably null Het
Sos1 T C 17: 80,408,311 T1006A probably benign Het
Sugp1 T A 8: 70,070,008 Y453N probably damaging Het
Taf3 A T 2: 10,042,644 D64E probably benign Het
Tcf19 A T 17: 35,515,904 probably null Het
Trim60 T A 8: 65,001,216 H127L probably damaging Het
Tubb4a C T 17: 57,080,770 V419M probably damaging Het
Vmn2r22 G T 6: 123,637,725 T302K probably damaging Het
Vmn2r68 T G 7: 85,221,676 T800P possibly damaging Het
Zfhx2 A C 14: 55,063,508 V2262G probably damaging Het
Other mutations in Hivep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Hivep1 APN 13 42154649 missense probably benign 0.00
IGL00572:Hivep1 APN 13 42158871 missense probably benign 0.00
IGL00820:Hivep1 APN 13 42183818 missense probably benign 0.29
IGL00846:Hivep1 APN 13 42167616 nonsense probably null
IGL01068:Hivep1 APN 13 42159984 missense probably benign 0.00
IGL01431:Hivep1 APN 13 42158017 missense probably damaging 0.96
IGL01664:Hivep1 APN 13 42159279 missense probably benign 0.18
IGL01833:Hivep1 APN 13 42154988 nonsense probably null
IGL02037:Hivep1 APN 13 42156077 missense probably benign 0.00
IGL02375:Hivep1 APN 13 42156449 missense probably benign 0.30
IGL02414:Hivep1 APN 13 42154909 missense probably damaging 0.99
IGL02609:Hivep1 APN 13 42155654 missense probably damaging 0.98
IGL02649:Hivep1 APN 13 42157311 missense possibly damaging 0.69
IGL02654:Hivep1 APN 13 42157685 missense probably damaging 0.97
IGL02977:Hivep1 APN 13 42155936 missense possibly damaging 0.94
IGL03124:Hivep1 APN 13 42158904 missense possibly damaging 0.66
IGL03050:Hivep1 UTSW 13 42156128 missense probably benign 0.12
R0067:Hivep1 UTSW 13 42158656 missense probably benign 0.00
R0067:Hivep1 UTSW 13 42158656 missense probably benign 0.00
R0078:Hivep1 UTSW 13 42156041 missense probably damaging 1.00
R0194:Hivep1 UTSW 13 42155435 missense probably damaging 1.00
R0195:Hivep1 UTSW 13 42156153 missense probably benign
R0245:Hivep1 UTSW 13 42164290 missense possibly damaging 0.93
R0654:Hivep1 UTSW 13 42159756 missense probably benign 0.16
R0655:Hivep1 UTSW 13 42167585 missense probably damaging 1.00
R0717:Hivep1 UTSW 13 42154946 missense possibly damaging 0.46
R1013:Hivep1 UTSW 13 42156962 missense probably damaging 1.00
R1216:Hivep1 UTSW 13 42157521 missense probably benign 0.03
R1256:Hivep1 UTSW 13 42181831 missense probably damaging 1.00
R1435:Hivep1 UTSW 13 42158043 missense probably damaging 1.00
R1437:Hivep1 UTSW 13 42157140 missense probably benign 0.03
R1438:Hivep1 UTSW 13 42158120 missense probably benign 0.00
R1672:Hivep1 UTSW 13 42160284 missense probably damaging 0.96
R1733:Hivep1 UTSW 13 42157931 missense probably damaging 1.00
R1762:Hivep1 UTSW 13 42183786 missense possibly damaging 0.80
R1786:Hivep1 UTSW 13 42183786 missense possibly damaging 0.80
R1909:Hivep1 UTSW 13 42155646 missense probably benign 0.38
R1993:Hivep1 UTSW 13 42157493 missense probably benign 0.00
R2004:Hivep1 UTSW 13 42160149 missense possibly damaging 0.47
R2061:Hivep1 UTSW 13 42160124 missense possibly damaging 0.80
R2069:Hivep1 UTSW 13 42183786 missense possibly damaging 0.80
R2075:Hivep1 UTSW 13 42156318 missense probably damaging 0.98
R2076:Hivep1 UTSW 13 42164393 critical splice donor site probably null
R2085:Hivep1 UTSW 13 42183750 missense probably benign 0.34
R3701:Hivep1 UTSW 13 42157727 missense probably benign 0.03
R3702:Hivep1 UTSW 13 42157727 missense probably benign 0.03
R3716:Hivep1 UTSW 13 42158495 missense probably damaging 1.00
R3718:Hivep1 UTSW 13 42158495 missense probably damaging 1.00
R3719:Hivep1 UTSW 13 42157727 missense probably benign 0.03
R3720:Hivep1 UTSW 13 42158601 missense probably benign 0.01
R3820:Hivep1 UTSW 13 42184311 missense possibly damaging 0.46
R3822:Hivep1 UTSW 13 42184311 missense possibly damaging 0.46
R3842:Hivep1 UTSW 13 42157727 missense probably benign 0.03
R4379:Hivep1 UTSW 13 42155430 missense probably damaging 1.00
R4525:Hivep1 UTSW 13 42155813 missense probably benign
R4587:Hivep1 UTSW 13 42156228 missense probably benign 0.00
R4604:Hivep1 UTSW 13 42159749 missense probably benign 0.08
R4686:Hivep1 UTSW 13 42155850 missense probably benign 0.00
R4725:Hivep1 UTSW 13 42163411 missense probably benign 0.19
R4924:Hivep1 UTSW 13 42158316 missense probably benign 0.20
R5009:Hivep1 UTSW 13 42158753 missense probably benign 0.06
R5320:Hivep1 UTSW 13 42159639 missense probably damaging 1.00
R5385:Hivep1 UTSW 13 42164395 splice site probably null
R5498:Hivep1 UTSW 13 42123158 critical splice acceptor site probably null
R5521:Hivep1 UTSW 13 42158328 missense probably damaging 1.00
R5529:Hivep1 UTSW 13 42156650 missense possibly damaging 0.81
R5584:Hivep1 UTSW 13 42160117 missense probably benign
R5635:Hivep1 UTSW 13 42160127 missense probably benign 0.16
R5636:Hivep1 UTSW 13 42163456 missense possibly damaging 0.92
R5886:Hivep1 UTSW 13 42156612 missense probably damaging 1.00
R5895:Hivep1 UTSW 13 42157218 missense possibly damaging 0.95
R5981:Hivep1 UTSW 13 42160188 missense probably damaging 1.00
R6012:Hivep1 UTSW 13 42184458 missense possibly damaging 0.50
R6033:Hivep1 UTSW 13 42157107 missense probably benign 0.20
R6033:Hivep1 UTSW 13 42157107 missense probably benign 0.20
R6037:Hivep1 UTSW 13 42157940 missense probably damaging 1.00
R6037:Hivep1 UTSW 13 42157940 missense probably damaging 1.00
R6241:Hivep1 UTSW 13 42158370 missense probably benign 0.01
R6247:Hivep1 UTSW 13 42157490 missense probably benign
R6343:Hivep1 UTSW 13 42159671 nonsense probably null
R6631:Hivep1 UTSW 13 42156480 missense probably damaging 0.96
R6720:Hivep1 UTSW 13 42164284 missense probably damaging 1.00
R6767:Hivep1 UTSW 13 42154727 missense probably damaging 0.99
R6797:Hivep1 UTSW 13 42157081 missense probably benign 0.00
R6800:Hivep1 UTSW 13 42157376 missense probably damaging 1.00
R6854:Hivep1 UTSW 13 42156507 missense probably damaging 1.00
R6919:Hivep1 UTSW 13 42183452 missense probably benign 0.00
R6993:Hivep1 UTSW 13 42158714 missense possibly damaging 0.94
R7104:Hivep1 UTSW 13 42157338 missense not run
R7139:Hivep1 UTSW 13 42159954 missense not run
X0060:Hivep1 UTSW 13 42154985 missense probably benign 0.07
X0067:Hivep1 UTSW 13 42156717 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGGCTGAGATAGAGCACTCCTCAAC -3'
(R):5'- ATGGTTTGGAGAGCTGCTGCAC -3'

Sequencing Primer
(F):5'- ACCGAGTCAAGCTTCGAGTC -3'
(R):5'- AGAGGTGACTATCTGAAGCTATG -3'
Posted On2013-05-09