Incidental Mutation 'R0245:Nhsl1'
ID36182
Institutional Source Beutler Lab
Gene Symbol Nhsl1
Ensembl Gene ENSMUSG00000039835
Gene NameNHS-like 1
Synonyms5730409E15Rik, D10Bwg0940e, A630035H13Rik
MMRRC Submission 038483-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0245 (G1)
Quality Score176
Status Validated
Chromosome10
Chromosomal Location18318985-18533892 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18525108 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 660 (K660R)
Ref Sequence ENSEMBL: ENSMUSP00000124072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037341] [ENSMUST00000100054] [ENSMUST00000162891] [ENSMUST00000207038]
Predicted Effect probably damaging
Transcript: ENSMUST00000037341
AA Change: K664R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000040799
Gene: ENSMUSG00000039835
AA Change: K664R

DomainStartEndE-ValueType
Pfam:NHS 258 906 1.6e-246 PFAM
low complexity region 918 938 N/A INTRINSIC
low complexity region 942 950 N/A INTRINSIC
low complexity region 958 970 N/A INTRINSIC
low complexity region 992 1024 N/A INTRINSIC
low complexity region 1171 1197 N/A INTRINSIC
low complexity region 1373 1385 N/A INTRINSIC
low complexity region 1442 1460 N/A INTRINSIC
low complexity region 1484 1503 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100054
AA Change: K660R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097631
Gene: ENSMUSG00000039835
AA Change: K660R

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 197 207 N/A INTRINSIC
Pfam:NHS 253 902 7.3e-250 PFAM
low complexity region 914 934 N/A INTRINSIC
low complexity region 938 946 N/A INTRINSIC
low complexity region 954 966 N/A INTRINSIC
low complexity region 988 1020 N/A INTRINSIC
low complexity region 1167 1193 N/A INTRINSIC
low complexity region 1369 1381 N/A INTRINSIC
low complexity region 1438 1456 N/A INTRINSIC
low complexity region 1480 1499 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159299
SMART Domains Protein: ENSMUSP00000124629
Gene: ENSMUSG00000039835

DomainStartEndE-ValueType
low complexity region 79 90 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162891
AA Change: K660R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124072
Gene: ENSMUSG00000039835
AA Change: K660R

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 197 207 N/A INTRINSIC
Pfam:NHS 253 902 2.1e-250 PFAM
low complexity region 914 934 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207038
AA Change: K694R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.352 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 99% (73/74)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik A G 8: 124,651,429 probably benign Het
Adgrg6 T A 10: 14,458,066 probably benign Het
Adra2a G C 19: 54,047,409 V399L probably damaging Het
Arpc1b A G 5: 145,126,860 D306G probably damaging Het
Asic3 C A 5: 24,413,838 R43S probably damaging Het
Astn2 T C 4: 65,794,558 D615G probably damaging Het
BC024978 T A 7: 27,200,603 C98S possibly damaging Het
Btbd2 A T 10: 80,647,806 Y178N probably damaging Het
Cacna1c T C 6: 118,604,454 N1647D probably benign Het
Cacna2d4 A T 6: 119,308,721 D803V probably damaging Het
Ccdc129 A G 6: 55,898,007 E314G probably damaging Het
Cdh26 C T 2: 178,481,632 R675C possibly damaging Het
Cdx2 C A 5: 147,306,473 K170N possibly damaging Het
Cmpk2 A T 12: 26,469,518 D56V probably benign Het
Dnah7a T C 1: 53,501,526 Y2563C probably damaging Het
Dock7 T C 4: 99,055,349 D552G possibly damaging Het
E2f7 C A 10: 110,774,795 S427* probably null Het
Eps8 T C 6: 137,479,128 D785G probably benign Het
Ereg G A 5: 91,074,800 C14Y possibly damaging Het
Fah A C 7: 84,595,498 H222Q probably benign Het
Fbxw16 T A 9: 109,436,168 S432C possibly damaging Het
Fdps A G 3: 89,093,771 S334P possibly damaging Het
Fgf7 A G 2: 126,035,955 K81E probably benign Het
Gfra1 T C 19: 58,300,554 N153S possibly damaging Het
Gm12355 T A 11: 98,625,241 probably benign Het
Golga1 A G 2: 39,035,259 V351A probably benign Het
Got1 A T 19: 43,504,507 probably benign Het
Greb1 T C 12: 16,696,456 Y1271C probably damaging Het
Gtf3c4 A G 2: 28,834,964 I252T possibly damaging Het
Gucy1a1 A G 3: 82,108,787 I298T possibly damaging Het
Hivep1 A G 13: 42,164,290 I2081V possibly damaging Het
Hps3 A T 3: 20,012,796 C535* probably null Het
Hspg2 T C 4: 137,514,722 F589S probably damaging Het
Itgb8 T A 12: 119,190,555 N249I probably damaging Het
Kdm4a T C 4: 118,175,689 D60G probably benign Het
Kng2 A T 16: 23,012,181 probably benign Het
March4 A T 1: 72,534,781 D119E probably benign Het
Mrpl34 T C 8: 71,465,075 probably benign Het
Ncoa6 C T 2: 155,391,211 G2059D probably benign Het
Nr2c2ap T C 8: 70,131,578 V6A possibly damaging Het
Olfr1209 C A 2: 88,909,875 D173Y possibly damaging Het
Olfr1302 A G 2: 111,780,335 N5S probably damaging Het
Olfr1404 T A 1: 173,215,957 I102N possibly damaging Het
Olfr177 A T 16: 58,872,866 Y95N probably benign Het
Olfr853 C A 9: 19,537,112 V273L probably benign Het
Oscar C T 7: 3,611,574 probably benign Het
Pkhd1 T C 1: 20,540,400 S1046G probably benign Het
Ptk6 T C 2: 181,202,491 D5G probably benign Het
Rgs12 A G 5: 35,030,080 H486R probably benign Het
Rnf111 C T 9: 70,453,831 probably benign Het
Rnf17 A G 14: 56,438,609 Y309C probably damaging Het
Rnf19a A T 15: 36,253,032 I387N probably damaging Het
Safb C T 17: 56,606,025 R914C probably damaging Het
Sdk1 A G 5: 141,954,958 T494A probably benign Het
Serac1 G T 17: 6,051,756 D384E probably damaging Het
Sez6l T C 5: 112,475,566 M40V probably benign Het
Slc17a5 A G 9: 78,540,924 I416T probably benign Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Spata32 C T 11: 103,209,095 A195T probably damaging Het
Srrd A G 5: 112,337,528 probably benign Het
Supt3 T C 17: 45,036,775 V208A probably benign Het
Taok3 G A 5: 117,252,679 probably benign Het
Tbxas1 G T 6: 39,027,768 R316S probably benign Het
Tgfbrap1 A T 1: 43,075,592 I116N possibly damaging Het
Tm7sf3 T C 6: 146,618,609 T260A possibly damaging Het
Top2a T C 11: 99,010,096 I556V probably benign Het
Uroc1 A G 6: 90,344,197 M252V probably damaging Het
Xpo4 G T 14: 57,630,240 H183Q probably damaging Het
Zcchc17 T A 4: 130,337,154 I81L probably benign Het
Zfp455 A T 13: 67,207,835 Y389F probably damaging Het
Other mutations in Nhsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Nhsl1 APN 10 18527609 missense probably benign 0.07
IGL01121:Nhsl1 APN 10 18511710 missense probably damaging 1.00
IGL01775:Nhsl1 APN 10 18524474 missense probably damaging 0.99
IGL02143:Nhsl1 APN 10 18511635 missense possibly damaging 0.74
IGL02606:Nhsl1 APN 10 18511637 missense probably damaging 1.00
IGL02642:Nhsl1 APN 10 18408390 missense possibly damaging 0.96
IGL02866:Nhsl1 APN 10 18527607 missense probably damaging 0.99
IGL03263:Nhsl1 APN 10 18498079 nonsense probably null
IGL03380:Nhsl1 APN 10 18523879 nonsense probably null
PIT4651001:Nhsl1 UTSW 10 18408435 missense probably damaging 0.98
R0046:Nhsl1 UTSW 10 18525669 missense probably damaging 1.00
R0046:Nhsl1 UTSW 10 18525669 missense probably damaging 1.00
R0116:Nhsl1 UTSW 10 18525242 nonsense probably null
R0254:Nhsl1 UTSW 10 18472985 missense probably damaging 1.00
R0288:Nhsl1 UTSW 10 18524046 missense probably damaging 1.00
R0648:Nhsl1 UTSW 10 18531726 missense possibly damaging 0.92
R1055:Nhsl1 UTSW 10 18525475 missense probably benign 0.08
R1300:Nhsl1 UTSW 10 18408461 missense probably benign
R1384:Nhsl1 UTSW 10 18408513 missense probably null 0.96
R1453:Nhsl1 UTSW 10 18531575 missense probably damaging 1.00
R1523:Nhsl1 UTSW 10 18408355 missense probably benign
R1595:Nhsl1 UTSW 10 18526348 missense probably damaging 0.98
R1786:Nhsl1 UTSW 10 18524664 missense probably benign 0.28
R1836:Nhsl1 UTSW 10 18524905 missense possibly damaging 0.87
R1878:Nhsl1 UTSW 10 18524279 missense probably damaging 1.00
R2013:Nhsl1 UTSW 10 18511592 missense probably damaging 1.00
R2014:Nhsl1 UTSW 10 18511592 missense probably damaging 1.00
R2015:Nhsl1 UTSW 10 18511592 missense probably damaging 1.00
R3115:Nhsl1 UTSW 10 18525168 missense probably damaging 1.00
R3116:Nhsl1 UTSW 10 18525168 missense probably damaging 1.00
R3754:Nhsl1 UTSW 10 18516034 missense probably damaging 0.99
R4342:Nhsl1 UTSW 10 18526689 missense probably damaging 1.00
R4595:Nhsl1 UTSW 10 18527609 missense probably benign 0.07
R4604:Nhsl1 UTSW 10 18531410 missense probably damaging 0.99
R4666:Nhsl1 UTSW 10 18531405 missense probably damaging 1.00
R5223:Nhsl1 UTSW 10 18526326 missense probably damaging 1.00
R5258:Nhsl1 UTSW 10 18524322 nonsense probably null
R5707:Nhsl1 UTSW 10 18526503 missense probably damaging 1.00
R5796:Nhsl1 UTSW 10 18524250 missense probably benign 0.06
R5960:Nhsl1 UTSW 10 18526976 missense probably benign
R6190:Nhsl1 UTSW 10 18470041 intron probably benign
R6272:Nhsl1 UTSW 10 18524505 missense probably benign 0.01
R6677:Nhsl1 UTSW 10 18525862 missense probably damaging 0.98
R6714:Nhsl1 UTSW 10 18524711 missense possibly damaging 0.74
R6765:Nhsl1 UTSW 10 18531314 missense probably benign 0.01
R6892:Nhsl1 UTSW 10 18524343 missense probably damaging 1.00
R7049:Nhsl1 UTSW 10 18531638 missense probably damaging 0.99
R7060:Nhsl1 UTSW 10 18526503 missense probably damaging 1.00
R7236:Nhsl1 UTSW 10 18525764 missense probably damaging 1.00
R7305:Nhsl1 UTSW 10 18531686 missense possibly damaging 0.94
R7513:Nhsl1 UTSW 10 18523952 missense probably damaging 1.00
R7566:Nhsl1 UTSW 10 18516119 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATACCAGGTCCCTGTGTTCAGAG -3'
(R):5'- GCTACTACCCTCGCTAACAATGCTC -3'

Sequencing Primer
(F):5'- TTCAGAGGACCATGATGGTTAC -3'
(R):5'- AGGGTTCCTCAAAGTCACTG -3'
Posted On2013-05-09