Incidental Mutation 'R0365:Pkd1l2'
ID36350
Institutional Source Beutler Lab
Gene Symbol Pkd1l2
Ensembl Gene ENSMUSG00000034416
Gene Namepolycystic kidney disease 1 like 2
Synonyms
MMRRC Submission 038571-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0365 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location116995679-117082449 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 117021850 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 1861 (V1861M)
Ref Sequence ENSEMBL: ENSMUSP00000104721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098375] [ENSMUST00000109093]
Predicted Effect probably benign
Transcript: ENSMUST00000098375
AA Change: V1860M

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000095977
Gene: ENSMUSG00000034416
AA Change: V1860M

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CLECT 26 152 1.56e-21 SMART
Pfam:Gal_Lectin 168 250 1.8e-18 PFAM
PKD 260 341 3.84e-1 SMART
low complexity region 496 507 N/A INTRINSIC
Pfam:REJ 510 886 1.8e-13 PFAM
low complexity region 1050 1060 N/A INTRINSIC
GPS 1278 1327 1.61e-11 SMART
transmembrane domain 1346 1365 N/A INTRINSIC
LH2 1390 1509 6.05e-13 SMART
transmembrane domain 1552 1574 N/A INTRINSIC
transmembrane domain 1589 1611 N/A INTRINSIC
transmembrane domain 1815 1837 N/A INTRINSIC
transmembrane domain 1852 1874 N/A INTRINSIC
transmembrane domain 1940 1962 N/A INTRINSIC
Pfam:PKD_channel 1980 2403 6.4e-107 PFAM
Pfam:Ion_trans 2187 2396 2.5e-12 PFAM
low complexity region 2441 2458 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109093
AA Change: V1861M

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000104721
Gene: ENSMUSG00000034416
AA Change: V1861M

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CLECT 26 152 1.56e-21 SMART
Pfam:Gal_Lectin 168 250 6.9e-19 PFAM
PKD 260 341 3.84e-1 SMART
low complexity region 496 507 N/A INTRINSIC
Pfam:REJ 519 883 7e-11 PFAM
low complexity region 1051 1061 N/A INTRINSIC
GPS 1279 1328 1.61e-11 SMART
transmembrane domain 1347 1366 N/A INTRINSIC
LH2 1391 1510 6.05e-13 SMART
transmembrane domain 1553 1575 N/A INTRINSIC
transmembrane domain 1590 1612 N/A INTRINSIC
transmembrane domain 1816 1838 N/A INTRINSIC
transmembrane domain 1853 1875 N/A INTRINSIC
transmembrane domain 1941 1963 N/A INTRINSIC
Pfam:PKD_channel 1981 2403 5.9e-106 PFAM
Pfam:Ion_trans 2138 2409 3.4e-12 PFAM
low complexity region 2442 2459 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160449
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162080
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded protein contains 11 transmembrane domains, a latrophilin/CL-1-like GPCR proteolytic site (GPS) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. This protein may function as a component of cation channel pores. This gene appears to be a polymorphic pseudogene in humans, where some individuals contain a non-functional allele. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,028,692 M173K probably benign Het
Abcb1b T A 5: 8,806,009 F39Y probably damaging Het
Acbd3 A G 1: 180,738,612 Y290C probably damaging Het
Alg12 A C 15: 88,816,149 I28R possibly damaging Het
Amer2 A T 14: 60,379,535 D393V probably damaging Het
Anxa5 A T 3: 36,457,469 V153D probably damaging Het
Arl5a T C 2: 52,416,129 M64V probably benign Het
Armc4 T A 18: 7,217,800 H638L probably benign Het
Astn1 T C 1: 158,688,548 L1236P probably damaging Het
Atg2a T C 19: 6,247,683 S424P possibly damaging Het
AW551984 A T 9: 39,599,321 S239R probably benign Het
Baz1b T C 5: 135,240,131 V1278A probably benign Het
Cbfa2t3 G T 8: 122,635,060 L408I probably benign Het
Cdc27 A T 11: 104,528,424 N227K possibly damaging Het
Cdh23 T A 10: 60,379,315 N1412I probably damaging Het
Cdh7 A T 1: 110,108,756 Q555H probably damaging Het
Cdhr2 T C 13: 54,718,292 S302P probably benign Het
Cep350 C A 1: 155,906,571 E1563D probably benign Het
Cfap221 T A 1: 119,985,023 E107V probably benign Het
Col6a3 C A 1: 90,788,216 R1641L unknown Het
Coro6 A T 11: 77,464,090 I60F probably benign Het
Dock10 G T 1: 80,595,683 N245K probably damaging Het
Epb41l2 T A 10: 25,469,221 N286K probably damaging Het
Fam83g G T 11: 61,703,109 E490* probably null Het
Gm13088 G T 4: 143,655,501 Y208* probably null Het
Gnb1l T C 16: 18,552,461 I234T possibly damaging Het
Gtf3a T A 5: 146,948,937 W53R probably damaging Het
Ikzf4 T C 10: 128,634,407 I415V probably benign Het
Il11ra1 T C 4: 41,767,527 V293A probably damaging Het
Il17ra G A 6: 120,478,449 V340M probably benign Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Kif24 A T 4: 41,428,731 H76Q probably benign Het
Klhl25 T C 7: 75,866,516 L390P probably damaging Het
Klhl26 T C 8: 70,451,829 D443G probably damaging Het
Lama3 A T 18: 12,507,007 R86S probably damaging Het
Lrrc24 G A 15: 76,715,784 A385V probably benign Het
Maea C T 5: 33,360,443 A109V probably benign Het
Mtor A T 4: 148,486,050 Y1188F probably benign Het
Nccrp1 T C 7: 28,544,552 D202G probably damaging Het
Nsun4 A T 4: 116,044,738 L177Q probably damaging Het
Nup155 C T 15: 8,131,543 R571W probably damaging Het
Nup160 T A 2: 90,708,844 M789K probably benign Het
Olfr262 A G 19: 12,241,076 F195S probably benign Het
Olfr469 A T 7: 107,822,917 L184* probably null Het
Olfr926 A T 9: 38,877,185 H3L probably benign Het
Pgpep1 G T 8: 70,652,524 probably null Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Plin4 G T 17: 56,104,667 T788K possibly damaging Het
Ppp3r2 T C 4: 49,681,902 D16G possibly damaging Het
Prdm16 A T 4: 154,342,056 I424N probably damaging Het
Psen2 T A 1: 180,228,845 I396F probably damaging Het
Psip1 C T 4: 83,485,712 probably null Het
Ptprd G A 4: 76,136,846 T215I probably damaging Het
Rec114 A G 9: 58,741,539 S2P probably benign Het
Rexo1 A G 10: 80,542,576 I1181T probably damaging Het
Rfx7 T C 9: 72,619,836 M1436T probably benign Het
Rnf213 T A 11: 119,426,111 V1020E possibly damaging Het
Rorc G A 3: 94,388,762 G83S probably damaging Het
Ryr2 T G 13: 11,668,839 Q3113P possibly damaging Het
Shank1 T C 7: 44,353,977 S1698P possibly damaging Het
Slc2a2 T C 3: 28,708,679 probably null Het
Slc5a9 A T 4: 111,891,836 Y98* probably null Het
Smc6 T C 12: 11,283,174 probably null Het
Sptb G T 12: 76,600,383 F1959L probably benign Het
Srgap1 T A 10: 121,785,705 H984L possibly damaging Het
Ssc5d T A 7: 4,928,467 C224* probably null Het
St5 A T 7: 109,538,949 V753E probably damaging Het
Ston2 A T 12: 91,647,860 H591Q probably benign Het
Tbx3 C T 5: 119,675,250 A222V possibly damaging Het
Thsd7a A G 6: 12,321,887 probably null Het
Usp9y T C Y: 1,364,732 D1027G probably damaging Het
Wnt5a C T 14: 28,518,504 R184* probably null Het
Zfpm2 A G 15: 40,774,066 E74G possibly damaging Het
Zwint C A 10: 72,657,295 S223* probably null Het
Other mutations in Pkd1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Pkd1l2 APN 8 117059520 nonsense probably null
IGL01353:Pkd1l2 APN 8 117057443 missense probably benign 0.24
IGL01362:Pkd1l2 APN 8 117021856 missense probably damaging 1.00
IGL01486:Pkd1l2 APN 8 117059592 missense probably benign
IGL01672:Pkd1l2 APN 8 117080732 missense possibly damaging 0.94
IGL01696:Pkd1l2 APN 8 117056387 missense probably benign 0.12
IGL01819:Pkd1l2 APN 8 116998174 missense probably damaging 1.00
IGL01833:Pkd1l2 APN 8 117060525 missense probably benign 0.00
IGL01981:Pkd1l2 APN 8 117016916 missense probably benign 0.04
IGL02066:Pkd1l2 APN 8 117009564 splice site probably benign
IGL02381:Pkd1l2 APN 8 117035800 splice site probably benign
IGL02416:Pkd1l2 APN 8 117040835 missense possibly damaging 0.82
IGL02736:Pkd1l2 APN 8 117040666 missense probably benign 0.00
IGL02828:Pkd1l2 APN 8 117029559 missense probably benign
IGL02861:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02862:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02883:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02884:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02894:Pkd1l2 APN 8 117013891 missense probably damaging 0.97
IGL02900:Pkd1l2 APN 8 117024091 missense probably benign 0.03
IGL02901:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02929:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02941:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02957:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL02969:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03028:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03059:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03065:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03066:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03083:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03084:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03124:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03162:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03165:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03335:Pkd1l2 APN 8 117065745 missense probably benign 0.07
IGL03357:Pkd1l2 APN 8 116995809 missense probably damaging 1.00
IGL02835:Pkd1l2 UTSW 8 117065745 missense probably benign 0.07
PIT4453001:Pkd1l2 UTSW 8 117022022 missense probably benign 0.00
R0127:Pkd1l2 UTSW 8 117050048 splice site probably benign
R0309:Pkd1l2 UTSW 8 116997576 missense probably damaging 0.99
R0526:Pkd1l2 UTSW 8 117082260 missense probably damaging 1.00
R0571:Pkd1l2 UTSW 8 117082218 missense probably benign 0.01
R0716:Pkd1l2 UTSW 8 117051100 missense probably damaging 1.00
R0787:Pkd1l2 UTSW 8 117076177 missense possibly damaging 0.90
R0893:Pkd1l2 UTSW 8 117044492 missense probably damaging 0.99
R1256:Pkd1l2 UTSW 8 117019543 critical splice acceptor site probably null
R1391:Pkd1l2 UTSW 8 117054934 missense possibly damaging 0.87
R1474:Pkd1l2 UTSW 8 117065497 splice site probably benign
R1491:Pkd1l2 UTSW 8 117028408 missense probably damaging 1.00
R1520:Pkd1l2 UTSW 8 117046159 missense probably benign 0.00
R1521:Pkd1l2 UTSW 8 117065500 splice site probably null
R1544:Pkd1l2 UTSW 8 117038235 frame shift probably null
R1558:Pkd1l2 UTSW 8 117082252 missense possibly damaging 0.94
R1673:Pkd1l2 UTSW 8 117040775 missense probably benign 0.00
R1691:Pkd1l2 UTSW 8 117056419 missense possibly damaging 0.60
R1754:Pkd1l2 UTSW 8 117030719 missense possibly damaging 0.81
R1857:Pkd1l2 UTSW 8 117040669 missense possibly damaging 0.70
R1939:Pkd1l2 UTSW 8 117046182 nonsense probably null
R1955:Pkd1l2 UTSW 8 117043361 missense probably benign
R1957:Pkd1l2 UTSW 8 117030682 missense probably damaging 1.00
R1959:Pkd1l2 UTSW 8 117043231 critical splice donor site probably null
R2024:Pkd1l2 UTSW 8 117019533 missense probably benign
R2046:Pkd1l2 UTSW 8 116999955 missense probably damaging 1.00
R2102:Pkd1l2 UTSW 8 117081469 missense probably damaging 0.98
R2116:Pkd1l2 UTSW 8 117030722 missense possibly damaging 0.93
R2148:Pkd1l2 UTSW 8 117056325 missense probably damaging 0.98
R2251:Pkd1l2 UTSW 8 117057438 missense probably damaging 1.00
R2252:Pkd1l2 UTSW 8 117057438 missense probably damaging 1.00
R2366:Pkd1l2 UTSW 8 117043317 missense probably benign 0.01
R2566:Pkd1l2 UTSW 8 117019494 missense probably damaging 1.00
R2872:Pkd1l2 UTSW 8 117038164 missense probably benign 0.10
R2872:Pkd1l2 UTSW 8 117038164 missense probably benign 0.10
R2985:Pkd1l2 UTSW 8 117065551 missense probably benign 0.00
R3055:Pkd1l2 UTSW 8 117068315 critical splice acceptor site probably null
R3436:Pkd1l2 UTSW 8 117040739 missense probably benign 0.01
R4732:Pkd1l2 UTSW 8 116995842 critical splice acceptor site probably null
R4733:Pkd1l2 UTSW 8 116995842 critical splice acceptor site probably null
R4763:Pkd1l2 UTSW 8 117019429 missense probably damaging 0.96
R4789:Pkd1l2 UTSW 8 117011575 missense probably damaging 0.99
R4921:Pkd1l2 UTSW 8 117054885 missense probably benign 0.03
R4921:Pkd1l2 UTSW 8 117072549 missense probably damaging 0.97
R4999:Pkd1l2 UTSW 8 117047374 splice site probably null
R5057:Pkd1l2 UTSW 8 117055008 missense probably benign 0.21
R5209:Pkd1l2 UTSW 8 117056442 missense probably benign 0.23
R5241:Pkd1l2 UTSW 8 117035118 missense probably damaging 1.00
R5480:Pkd1l2 UTSW 8 117030649 missense probably damaging 0.99
R5501:Pkd1l2 UTSW 8 117065830 missense probably damaging 0.98
R5533:Pkd1l2 UTSW 8 117068116 missense probably benign 0.03
R5582:Pkd1l2 UTSW 8 117040783 nonsense probably null
R5610:Pkd1l2 UTSW 8 117042320 missense probably benign 0.04
R5770:Pkd1l2 UTSW 8 117055018 missense probably damaging 1.00
R5854:Pkd1l2 UTSW 8 117065746 missense possibly damaging 0.48
R5867:Pkd1l2 UTSW 8 117055011 missense probably damaging 0.96
R5881:Pkd1l2 UTSW 8 116997582 missense probably damaging 0.99
R5906:Pkd1l2 UTSW 8 117029648 missense probably damaging 1.00
R5909:Pkd1l2 UTSW 8 117024056 missense probably benign 0.00
R6030:Pkd1l2 UTSW 8 117043237 missense probably damaging 1.00
R6030:Pkd1l2 UTSW 8 117043237 missense probably damaging 1.00
R6084:Pkd1l2 UTSW 8 117013987 missense probably damaging 1.00
R6122:Pkd1l2 UTSW 8 117082368 missense probably benign 0.02
R6216:Pkd1l2 UTSW 8 117081470 missense probably damaging 1.00
R6406:Pkd1l2 UTSW 8 117035847 missense probably damaging 0.99
R6417:Pkd1l2 UTSW 8 117013899 missense probably damaging 1.00
R6420:Pkd1l2 UTSW 8 117013899 missense probably damaging 1.00
R6601:Pkd1l2 UTSW 8 117040666 missense probably benign 0.00
R6743:Pkd1l2 UTSW 8 117030631 missense probably damaging 1.00
R7053:Pkd1l2 UTSW 8 117013942 missense probably damaging 1.00
R7144:Pkd1l2 UTSW 8 117076131 nonsense probably null
R7148:Pkd1l2 UTSW 8 117080786 missense probably benign 0.00
R7169:Pkd1l2 UTSW 8 117040835 missense possibly damaging 0.82
R7217:Pkd1l2 UTSW 8 116995797 missense probably benign 0.24
R7310:Pkd1l2 UTSW 8 117024034 missense probably benign
R7382:Pkd1l2 UTSW 8 117054871 missense possibly damaging 0.95
R7397:Pkd1l2 UTSW 8 117035902 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CAGAGGTAGTAGCCCATGTGTTTGC -3'
(R):5'- GCTTGCACAAGGCCATTTGGAG -3'

Sequencing Primer
(F):5'- CCATGTGTTTGCCAAATGAACATTG -3'
(R):5'- ATGAGAACAGATGGGTCTTCTGG -3'
Posted On2013-05-09