Incidental Mutation 'R0365:AW551984'
ID36353
Institutional Source Beutler Lab
Gene Symbol AW551984
Ensembl Gene ENSMUSG00000038112
Gene Nameexpressed sequence AW551984
Synonyms
MMRRC Submission 038571-MU
Accession Numbers

Genbank: NM_178737; MGI: 2143322

Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R0365 (G1)
Quality Score223
Status Not validated
Chromosome9
Chromosomal Location39587396-39604403 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 39599321 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 239 (S239R)
Ref Sequence ENSEMBL: ENSMUSP00000113212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042485] [ENSMUST00000119722] [ENSMUST00000130829] [ENSMUST00000141370]
Predicted Effect probably benign
Transcript: ENSMUST00000042485
AA Change: S239R

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000042582
Gene: ENSMUSG00000038112
AA Change: S239R

DomainStartEndE-ValueType
VIT 1 131 1.59e-47 SMART
VWA 279 460 1.04e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119722
AA Change: S239R

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000113212
Gene: ENSMUSG00000038112
AA Change: S239R

DomainStartEndE-ValueType
VIT 1 131 1.59e-47 SMART
VWA 279 460 1.04e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130829
SMART Domains Protein: ENSMUSP00000117262
Gene: ENSMUSG00000038112

DomainStartEndE-ValueType
Pfam:VIT_2 5 52 1.4e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136814
Predicted Effect probably benign
Transcript: ENSMUST00000141370
SMART Domains Protein: ENSMUSP00000117328
Gene: ENSMUSG00000038112

DomainStartEndE-ValueType
VIT 1 131 1.59e-47 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,028,692 M173K probably benign Het
Abcb1b T A 5: 8,806,009 F39Y probably damaging Het
Acbd3 A G 1: 180,738,612 Y290C probably damaging Het
Alg12 A C 15: 88,816,149 I28R possibly damaging Het
Amer2 A T 14: 60,379,535 D393V probably damaging Het
Anxa5 A T 3: 36,457,469 V153D probably damaging Het
Arl5a T C 2: 52,416,129 M64V probably benign Het
Armc4 T A 18: 7,217,800 H638L probably benign Het
Astn1 T C 1: 158,688,548 L1236P probably damaging Het
Atg2a T C 19: 6,247,683 S424P possibly damaging Het
Baz1b T C 5: 135,240,131 V1278A probably benign Het
Cbfa2t3 G T 8: 122,635,060 L408I probably benign Het
Cdc27 A T 11: 104,528,424 N227K possibly damaging Het
Cdh23 T A 10: 60,379,315 N1412I probably damaging Het
Cdh7 A T 1: 110,108,756 Q555H probably damaging Het
Cdhr2 T C 13: 54,718,292 S302P probably benign Het
Cep350 C A 1: 155,906,571 E1563D probably benign Het
Cfap221 T A 1: 119,985,023 E107V probably benign Het
Col6a3 C A 1: 90,788,216 R1641L unknown Het
Coro6 A T 11: 77,464,090 I60F probably benign Het
Dock10 G T 1: 80,595,683 N245K probably damaging Het
Epb41l2 T A 10: 25,469,221 N286K probably damaging Het
Fam83g G T 11: 61,703,109 E490* probably null Het
Gm13088 G T 4: 143,655,501 Y208* probably null Het
Gnb1l T C 16: 18,552,461 I234T possibly damaging Het
Gtf3a T A 5: 146,948,937 W53R probably damaging Het
Ikzf4 T C 10: 128,634,407 I415V probably benign Het
Il11ra1 T C 4: 41,767,527 V293A probably damaging Het
Il17ra G A 6: 120,478,449 V340M probably benign Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Kif24 A T 4: 41,428,731 H76Q probably benign Het
Klhl25 T C 7: 75,866,516 L390P probably damaging Het
Klhl26 T C 8: 70,451,829 D443G probably damaging Het
Lama3 A T 18: 12,507,007 R86S probably damaging Het
Lrrc24 G A 15: 76,715,784 A385V probably benign Het
Maea C T 5: 33,360,443 A109V probably benign Het
Mtor A T 4: 148,486,050 Y1188F probably benign Het
Nccrp1 T C 7: 28,544,552 D202G probably damaging Het
Nsun4 A T 4: 116,044,738 L177Q probably damaging Het
Nup155 C T 15: 8,131,543 R571W probably damaging Het
Nup160 T A 2: 90,708,844 M789K probably benign Het
Olfr262 A G 19: 12,241,076 F195S probably benign Het
Olfr469 A T 7: 107,822,917 L184* probably null Het
Olfr926 A T 9: 38,877,185 H3L probably benign Het
Pgpep1 G T 8: 70,652,524 probably null Het
Pkd1l2 C T 8: 117,021,850 V1861M probably benign Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Plin4 G T 17: 56,104,667 T788K possibly damaging Het
Ppp3r2 T C 4: 49,681,902 D16G possibly damaging Het
Prdm16 A T 4: 154,342,056 I424N probably damaging Het
Psen2 T A 1: 180,228,845 I396F probably damaging Het
Psip1 C T 4: 83,485,712 probably null Het
Ptprd G A 4: 76,136,846 T215I probably damaging Het
Rec114 A G 9: 58,741,539 S2P probably benign Het
Rexo1 A G 10: 80,542,576 I1181T probably damaging Het
Rfx7 T C 9: 72,619,836 M1436T probably benign Het
Rnf213 T A 11: 119,426,111 V1020E possibly damaging Het
Rorc G A 3: 94,388,762 G83S probably damaging Het
Ryr2 T G 13: 11,668,839 Q3113P possibly damaging Het
Shank1 T C 7: 44,353,977 S1698P possibly damaging Het
Slc2a2 T C 3: 28,708,679 probably null Het
Slc5a9 A T 4: 111,891,836 Y98* probably null Het
Smc6 T C 12: 11,283,174 probably null Het
Sptb G T 12: 76,600,383 F1959L probably benign Het
Srgap1 T A 10: 121,785,705 H984L possibly damaging Het
Ssc5d T A 7: 4,928,467 C224* probably null Het
St5 A T 7: 109,538,949 V753E probably damaging Het
Ston2 A T 12: 91,647,860 H591Q probably benign Het
Tbx3 C T 5: 119,675,250 A222V possibly damaging Het
Thsd7a A G 6: 12,321,887 probably null Het
Usp9y T C Y: 1,364,732 D1027G probably damaging Het
Wnt5a C T 14: 28,518,504 R184* probably null Het
Zfpm2 A G 15: 40,774,066 E74G possibly damaging Het
Zwint C A 10: 72,657,295 S223* probably null Het
Other mutations in AW551984
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:AW551984 APN 9 39592849 missense probably benign 0.16
IGL00869:AW551984 APN 9 39593434 splice site probably benign
IGL01411:AW551984 APN 9 39593791 missense possibly damaging 0.69
IGL01744:AW551984 APN 9 39591272 missense probably benign 0.01
IGL02102:AW551984 APN 9 39589691 missense probably damaging 1.00
IGL02149:AW551984 APN 9 39592924 missense probably benign 0.06
IGL02151:AW551984 APN 9 39592945 missense probably benign 0.35
IGL02154:AW551984 APN 9 39589102 missense possibly damaging 0.93
IGL02158:AW551984 APN 9 39599325 missense probably null 0.99
IGL02574:AW551984 APN 9 39589086 missense possibly damaging 0.91
IGL02754:AW551984 APN 9 39596626 nonsense probably null
IGL02754:AW551984 APN 9 39593328 critical splice donor site probably null
IGL02838:AW551984 APN 9 39594643 missense probably damaging 1.00
IGL03240:AW551984 APN 9 39589122 missense probably benign 0.00
IGL03328:AW551984 APN 9 39597116 missense probably damaging 1.00
IGL03374:AW551984 APN 9 39599766 missense possibly damaging 0.52
PIT4260001:AW551984 UTSW 9 39592979 missense probably benign 0.08
R0141:AW551984 UTSW 9 39590644 missense probably damaging 1.00
R0269:AW551984 UTSW 9 39599950 missense probably damaging 1.00
R0453:AW551984 UTSW 9 39600641 missense probably damaging 1.00
R0481:AW551984 UTSW 9 39600616 missense probably null 1.00
R1005:AW551984 UTSW 9 39593733 nonsense probably null
R1585:AW551984 UTSW 9 39599336 nonsense probably null
R2177:AW551984 UTSW 9 39599815 missense probably benign
R3117:AW551984 UTSW 9 39593360 missense probably benign 0.08
R3119:AW551984 UTSW 9 39593360 missense probably benign 0.08
R3162:AW551984 UTSW 9 39593029 missense probably damaging 1.00
R3162:AW551984 UTSW 9 39593029 missense probably damaging 1.00
R3836:AW551984 UTSW 9 39597908 unclassified probably benign
R3837:AW551984 UTSW 9 39597908 unclassified probably benign
R3839:AW551984 UTSW 9 39597908 unclassified probably benign
R4299:AW551984 UTSW 9 39592979 missense probably benign 0.08
R4422:AW551984 UTSW 9 39600077 missense probably null 0.00
R4713:AW551984 UTSW 9 39597153 missense probably benign 0.13
R4905:AW551984 UTSW 9 39597158 missense probably damaging 0.99
R4966:AW551984 UTSW 9 39597176 missense possibly damaging 0.92
R5022:AW551984 UTSW 9 39597965 missense probably benign 0.00
R5041:AW551984 UTSW 9 39600598 missense probably damaging 1.00
R5342:AW551984 UTSW 9 39594551 missense probably damaging 1.00
R5383:AW551984 UTSW 9 39590698 missense probably benign
R5443:AW551984 UTSW 9 39598029 missense possibly damaging 0.94
R5532:AW551984 UTSW 9 39597185 missense probably damaging 1.00
R5536:AW551984 UTSW 9 39592873 missense probably benign 0.04
R5586:AW551984 UTSW 9 39591263 missense probably benign 0.01
R5601:AW551984 UTSW 9 39591267 missense possibly damaging 0.87
R5618:AW551984 UTSW 9 39590704 missense probably damaging 1.00
R5701:AW551984 UTSW 9 39592822 missense probably benign 0.01
R6122:AW551984 UTSW 9 39593755 missense probably benign 0.00
R6142:AW551984 UTSW 9 39597114 missense probably benign 0.00
R6272:AW551984 UTSW 9 39598037 missense probably benign 0.06
R6429:AW551984 UTSW 9 39600614 missense probably damaging 1.00
R6659:AW551984 UTSW 9 39589099 missense probably benign 0.00
R6670:AW551984 UTSW 9 39592996 missense probably damaging 1.00
R6791:AW551984 UTSW 9 39600659 missense probably damaging 1.00
R7000:AW551984 UTSW 9 39600789 missense probably benign 0.11
R7077:AW551984 UTSW 9 39591427 missense probably benign
R7083:AW551984 UTSW 9 39597647 missense probably damaging 1.00
R7352:AW551984 UTSW 9 39592925 missense probably benign
R7475:AW551984 UTSW 9 39597940 missense probably damaging 1.00
R7534:AW551984 UTSW 9 39591481 missense probably benign 0.03
R7542:AW551984 UTSW 9 39594631 missense possibly damaging 0.95
Z1088:AW551984 UTSW 9 39590603 nonsense probably null
ZE80:AW551984 UTSW 9 39593667 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGGTTAGAGAAGTGTGAGGACCTTCAG -3'
(R):5'- GTGCAAGAGTTCCCAGTCCTTTAGTG -3'

Sequencing Primer
(F):5'- GTGAGGACCTTCAGTATTTCAGAC -3'
(R):5'- ATTGAACTCGTGGTCCTCATC -3'
Posted On2013-05-09