Incidental Mutation 'R0365:Smc6'
ID36367
Institutional Source Beutler Lab
Gene Symbol Smc6
Ensembl Gene ENSMUSG00000020608
Gene Namestructural maintenance of chromosomes 6
Synonyms2810489L22Rik, 3830418C19Rik, Smc6l1
MMRRC Submission 038571-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0365 (G1)
Quality Score218
Status Not validated
Chromosome12
Chromosomal Location11265886-11319785 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 11283174 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020931] [ENSMUST00000217906] [ENSMUST00000218022] [ENSMUST00000218866] [ENSMUST00000219776]
Predicted Effect probably null
Transcript: ENSMUST00000020931
SMART Domains Protein: ENSMUSP00000020931
Gene: ENSMUSG00000020608

DomainStartEndE-ValueType
Pfam:SMC_N 53 1077 4.7e-17 PFAM
Pfam:AAA_15 54 438 3.1e-9 PFAM
Pfam:AAA_23 56 398 5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217906
Predicted Effect probably benign
Transcript: ENSMUST00000218022
Predicted Effect probably null
Transcript: ENSMUST00000218866
Predicted Effect probably benign
Transcript: ENSMUST00000219776
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit poor embryonic development and embryonic lethality by E105. Mice homozygous for a hypomorphic allele exhibit decreased body weight and weight, decreased litter size and partial lethality. Mice homozygous for a point mutation exhibit a milder phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,028,692 M173K probably benign Het
Abcb1b T A 5: 8,806,009 F39Y probably damaging Het
Acbd3 A G 1: 180,738,612 Y290C probably damaging Het
Alg12 A C 15: 88,816,149 I28R possibly damaging Het
Amer2 A T 14: 60,379,535 D393V probably damaging Het
Anxa5 A T 3: 36,457,469 V153D probably damaging Het
Arl5a T C 2: 52,416,129 M64V probably benign Het
Armc4 T A 18: 7,217,800 H638L probably benign Het
Astn1 T C 1: 158,688,548 L1236P probably damaging Het
Atg2a T C 19: 6,247,683 S424P possibly damaging Het
AW551984 A T 9: 39,599,321 S239R probably benign Het
Baz1b T C 5: 135,240,131 V1278A probably benign Het
Cbfa2t3 G T 8: 122,635,060 L408I probably benign Het
Cdc27 A T 11: 104,528,424 N227K possibly damaging Het
Cdh23 T A 10: 60,379,315 N1412I probably damaging Het
Cdh7 A T 1: 110,108,756 Q555H probably damaging Het
Cdhr2 T C 13: 54,718,292 S302P probably benign Het
Cep350 C A 1: 155,906,571 E1563D probably benign Het
Cfap221 T A 1: 119,985,023 E107V probably benign Het
Col6a3 C A 1: 90,788,216 R1641L unknown Het
Coro6 A T 11: 77,464,090 I60F probably benign Het
Dock10 G T 1: 80,595,683 N245K probably damaging Het
Epb41l2 T A 10: 25,469,221 N286K probably damaging Het
Fam83g G T 11: 61,703,109 E490* probably null Het
Gm13088 G T 4: 143,655,501 Y208* probably null Het
Gnb1l T C 16: 18,552,461 I234T possibly damaging Het
Gtf3a T A 5: 146,948,937 W53R probably damaging Het
Ikzf4 T C 10: 128,634,407 I415V probably benign Het
Il11ra1 T C 4: 41,767,527 V293A probably damaging Het
Il17ra G A 6: 120,478,449 V340M probably benign Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Kif24 A T 4: 41,428,731 H76Q probably benign Het
Klhl25 T C 7: 75,866,516 L390P probably damaging Het
Klhl26 T C 8: 70,451,829 D443G probably damaging Het
Lama3 A T 18: 12,507,007 R86S probably damaging Het
Lrrc24 G A 15: 76,715,784 A385V probably benign Het
Maea C T 5: 33,360,443 A109V probably benign Het
Mtor A T 4: 148,486,050 Y1188F probably benign Het
Nccrp1 T C 7: 28,544,552 D202G probably damaging Het
Nsun4 A T 4: 116,044,738 L177Q probably damaging Het
Nup155 C T 15: 8,131,543 R571W probably damaging Het
Nup160 T A 2: 90,708,844 M789K probably benign Het
Olfr262 A G 19: 12,241,076 F195S probably benign Het
Olfr469 A T 7: 107,822,917 L184* probably null Het
Olfr926 A T 9: 38,877,185 H3L probably benign Het
Pgpep1 G T 8: 70,652,524 probably null Het
Pkd1l2 C T 8: 117,021,850 V1861M probably benign Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Plin4 G T 17: 56,104,667 T788K possibly damaging Het
Ppp3r2 T C 4: 49,681,902 D16G possibly damaging Het
Prdm16 A T 4: 154,342,056 I424N probably damaging Het
Psen2 T A 1: 180,228,845 I396F probably damaging Het
Psip1 C T 4: 83,485,712 probably null Het
Ptprd G A 4: 76,136,846 T215I probably damaging Het
Rec114 A G 9: 58,741,539 S2P probably benign Het
Rexo1 A G 10: 80,542,576 I1181T probably damaging Het
Rfx7 T C 9: 72,619,836 M1436T probably benign Het
Rnf213 T A 11: 119,426,111 V1020E possibly damaging Het
Rorc G A 3: 94,388,762 G83S probably damaging Het
Ryr2 T G 13: 11,668,839 Q3113P possibly damaging Het
Shank1 T C 7: 44,353,977 S1698P possibly damaging Het
Slc2a2 T C 3: 28,708,679 probably null Het
Slc5a9 A T 4: 111,891,836 Y98* probably null Het
Sptb G T 12: 76,600,383 F1959L probably benign Het
Srgap1 T A 10: 121,785,705 H984L possibly damaging Het
Ssc5d T A 7: 4,928,467 C224* probably null Het
St5 A T 7: 109,538,949 V753E probably damaging Het
Ston2 A T 12: 91,647,860 H591Q probably benign Het
Tbx3 C T 5: 119,675,250 A222V possibly damaging Het
Thsd7a A G 6: 12,321,887 probably null Het
Usp9y T C Y: 1,364,732 D1027G probably damaging Het
Wnt5a C T 14: 28,518,504 R184* probably null Het
Zfpm2 A G 15: 40,774,066 E74G possibly damaging Het
Zwint C A 10: 72,657,295 S223* probably null Het
Other mutations in Smc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Smc6 APN 12 11299263 missense possibly damaging 0.48
IGL00562:Smc6 APN 12 11301531 missense probably benign 0.02
IGL00563:Smc6 APN 12 11301531 missense probably benign 0.02
IGL01420:Smc6 APN 12 11291658 missense probably benign 0.27
IGL02299:Smc6 APN 12 11290751 missense probably benign 0.00
R0207:Smc6 UTSW 12 11283178 unclassified probably benign
R0669:Smc6 UTSW 12 11289164 missense probably benign 0.41
R0732:Smc6 UTSW 12 11290817 missense probably damaging 0.96
R1398:Smc6 UTSW 12 11271879 splice site probably benign
R1509:Smc6 UTSW 12 11279733 missense possibly damaging 0.55
R1739:Smc6 UTSW 12 11317853 missense probably benign 0.05
R1775:Smc6 UTSW 12 11309269 missense probably benign 0.00
R1815:Smc6 UTSW 12 11294601 critical splice donor site probably null
R1937:Smc6 UTSW 12 11299398 missense probably benign 0.06
R2090:Smc6 UTSW 12 11289986 missense probably benign 0.08
R2885:Smc6 UTSW 12 11276293 missense probably damaging 0.99
R2886:Smc6 UTSW 12 11276293 missense probably damaging 0.99
R2991:Smc6 UTSW 12 11289981 missense probably damaging 0.96
R3825:Smc6 UTSW 12 11301516 splice site probably benign
R3967:Smc6 UTSW 12 11298326 missense probably benign 0.13
R3975:Smc6 UTSW 12 11274074 missense probably damaging 0.99
R4660:Smc6 UTSW 12 11274007 missense probably damaging 1.00
R5372:Smc6 UTSW 12 11282430 missense probably damaging 1.00
R5412:Smc6 UTSW 12 11285399 missense possibly damaging 0.88
R5523:Smc6 UTSW 12 11291539 missense probably benign 0.31
R5643:Smc6 UTSW 12 11289994 missense probably benign 0.18
R5644:Smc6 UTSW 12 11289994 missense probably benign 0.18
R5782:Smc6 UTSW 12 11290834 missense probably damaging 1.00
R6027:Smc6 UTSW 12 11306178 missense probably benign 0.04
R6083:Smc6 UTSW 12 11276353 missense possibly damaging 0.95
R6344:Smc6 UTSW 12 11297106 intron probably benign
R6374:Smc6 UTSW 12 11305873 intron probably null
R6430:Smc6 UTSW 12 11309234 missense probably benign 0.00
R6539:Smc6 UTSW 12 11297010 unclassified probably null
R6767:Smc6 UTSW 12 11271820 missense possibly damaging 0.93
R7042:Smc6 UTSW 12 11309300 missense probably damaging 1.00
R7128:Smc6 UTSW 12 11301631 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACGTTTTGAGGGCCAAATTTTCTCTTT -3'
(R):5'- CCAGTGATGCCTTGCACAACCA -3'

Sequencing Primer
(F):5'- CTTTGTTTTTACACTACAAGCCTAC -3'
(R):5'- tgtatgaatacacacacacacac -3'
Posted On2013-05-09