Incidental Mutation 'R0366:Olfr1259'
ID36394
Institutional Source Beutler Lab
Gene Symbol Olfr1259
Ensembl Gene ENSMUSG00000068806
Gene Nameolfactory receptor 1259
SynonymsGA_x6K02T2Q125-51376062-51375133, MOR232-9
MMRRC Submission 038572-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R0366 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location89940532-89948664 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 89943818 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 99 (V99G)
Ref Sequence ENSEMBL: ENSMUSP00000149652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090695] [ENSMUST00000214846]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090695
AA Change: V99G

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000088194
Gene: ENSMUSG00000068806
AA Change: V99G

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 8.9e-45 PFAM
Pfam:7tm_1 39 285 5.5e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214846
AA Change: V99G

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.0592 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 G T 17: 46,324,798 S93* probably null Het
Ackr2 T C 9: 121,909,360 L267P probably damaging Het
Adgre4 T A 17: 55,792,001 L169* probably null Het
AI481877 A C 4: 59,099,410 M94R probably benign Het
Ankrd12 T A 17: 65,984,506 S1311C possibly damaging Het
Arid2 T A 15: 96,361,720 probably benign Het
Atp9b A T 18: 80,762,102 V747E probably damaging Het
Best1 T C 19: 9,992,053 probably null Het
Brwd1 C A 16: 96,037,964 E836* probably null Het
Cachd1 A G 4: 100,994,737 S1177G possibly damaging Het
Cacna1e C T 1: 154,416,138 E1766K probably benign Het
Cckar A G 5: 53,700,165 I301T probably benign Het
Cdc27 T G 11: 104,505,648 T816P probably damaging Het
Cep162 T G 9: 87,220,484 Q708H probably damaging Het
Cep250 C A 2: 155,988,401 D1301E probably benign Het
D430041D05Rik G A 2: 104,255,340 H955Y probably damaging Het
Dcdc2a T A 13: 25,056,434 V55E probably damaging Het
Efcab12 A G 6: 115,823,248 probably benign Het
Ep400 A G 5: 110,701,671 V1428A unknown Het
Erbb3 T C 10: 128,572,570 E825G possibly damaging Het
Evl A T 12: 108,686,048 probably null Het
Fuca2 G A 10: 13,505,763 R140H probably benign Het
Gm4969 T A 7: 19,107,039 I57F probably damaging Het
Gm5581 T C 6: 131,166,447 noncoding transcript Het
Gm7052 T C 17: 22,040,517 probably benign Het
Gpd1 T G 15: 99,719,270 I119S probably damaging Het
Gzmc A T 14: 56,232,736 Y101* probably null Het
Hmcn2 G T 2: 31,424,206 A3588S possibly damaging Het
Ikbkb A G 8: 22,695,260 probably benign Het
Itgax G T 7: 128,149,089 probably benign Het
Kif24 C A 4: 41,428,717 S81I possibly damaging Het
Lct G A 1: 128,286,462 P1858S probably benign Het
Map2k1 C A 9: 64,193,702 probably null Het
Mdga1 A G 17: 29,857,708 V30A possibly damaging Het
Mtcl1 G A 17: 66,338,129 P1441L probably damaging Het
N4bp2 T A 5: 65,806,396 F596Y possibly damaging Het
Notch4 A T 17: 34,581,499 probably benign Het
Olfr1061 A G 2: 86,414,025 V9A possibly damaging Het
Olfr167 A G 16: 19,514,848 S263P probably benign Het
Olfr802 A G 10: 129,681,971 M256T possibly damaging Het
Olfr907 T A 9: 38,499,154 C162S possibly damaging Het
Pbld2 A G 10: 63,053,957 probably benign Het
Phip T C 9: 82,926,407 Y505C probably damaging Het
Plcb2 A G 2: 118,724,447 F58L probably benign Het
Plcd1 T A 9: 119,081,136 I72F probably damaging Het
Ppp5c A T 7: 17,022,583 Y63* probably null Het
Prdm4 T C 10: 85,908,004 D129G probably damaging Het
Prkcq C A 2: 11,246,838 probably benign Het
Rab5b C T 10: 128,682,903 R120Q probably benign Het
Rab7b T A 1: 131,698,504 V90D probably damaging Het
Ripk3 T C 14: 55,786,835 T193A probably damaging Het
Rnf167 C T 11: 70,649,317 R88* probably null Het
Robo1 A G 16: 72,742,245 T59A possibly damaging Het
Scd2 G A 19: 44,301,246 V227I probably benign Het
Scg3 T A 9: 75,675,338 probably benign Het
Sec31a A T 5: 100,382,766 L677H probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Setd7 T C 3: 51,550,320 T29A probably benign Het
Slc4a5 A G 6: 83,295,872 Y942C probably benign Het
Slit1 T A 19: 41,611,031 Y1027F probably damaging Het
Sptan1 G A 2: 29,992,752 probably null Het
Tdrd12 T C 7: 35,508,802 Q249R probably benign Het
Tmem171 T A 13: 98,692,228 D138V possibly damaging Het
Ttll10 G A 4: 156,035,155 R596W probably damaging Het
Usp53 G T 3: 122,949,201 N695K probably damaging Het
Vmn2r25 A T 6: 123,823,622 L587* probably null Het
Zglp1 C T 9: 21,063,379 C171Y probably benign Het
Other mutations in Olfr1259
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Olfr1259 APN 2 89943260 missense probably damaging 0.96
IGL01446:Olfr1259 APN 2 89943938 missense probably damaging 0.99
IGL01830:Olfr1259 APN 2 89943431 missense probably benign 0.03
IGL02160:Olfr1259 APN 2 89943805 missense probably damaging 1.00
PIT4280001:Olfr1259 UTSW 2 89943743 missense probably damaging 1.00
R0550:Olfr1259 UTSW 2 89943389 missense probably damaging 0.99
R0587:Olfr1259 UTSW 2 89943392 missense probably damaging 1.00
R1383:Olfr1259 UTSW 2 89943551 missense probably benign 0.12
R1400:Olfr1259 UTSW 2 89943542 missense possibly damaging 0.82
R1851:Olfr1259 UTSW 2 89943814 nonsense probably null
R1953:Olfr1259 UTSW 2 89943923 missense probably damaging 1.00
R2330:Olfr1259 UTSW 2 89943953 missense probably benign
R3897:Olfr1259 UTSW 2 89943809 missense probably benign 0.24
R3955:Olfr1259 UTSW 2 89943828 missense possibly damaging 0.90
R4687:Olfr1259 UTSW 2 89943869 missense probably damaging 0.98
R4976:Olfr1259 UTSW 2 89943803 missense possibly damaging 0.77
R5119:Olfr1259 UTSW 2 89943803 missense possibly damaging 0.77
R5291:Olfr1259 UTSW 2 89943436 nonsense probably null
R5415:Olfr1259 UTSW 2 89943387 missense probably benign 0.25
R5546:Olfr1259 UTSW 2 89943585 missense probably damaging 1.00
R5588:Olfr1259 UTSW 2 89943792 missense probably benign 0.00
R6633:Olfr1259 UTSW 2 89943366 missense probably benign
R6858:Olfr1259 UTSW 2 89943743 missense probably damaging 0.99
R7294:Olfr1259 UTSW 2 89943724 nonsense probably null
Z1088:Olfr1259 UTSW 2 89943770 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTTGGCAGCCACAAAGAGACC -3'
(R):5'- TCAACAGCCAGGCTCTGAATTCCC -3'

Sequencing Primer
(F):5'- GTGTGTCCATGCAAACAAGTTC -3'
(R):5'- AATTCCCCCATGTATTTCTTCCTGAG -3'
Posted On2013-05-09