Incidental Mutation 'R0366:Olfr802'
ID36429
Institutional Source Beutler Lab
Gene Symbol Olfr802
Ensembl Gene ENSMUSG00000093866
Gene Nameolfactory receptor 802
SynonymsGA_x6K02T2PULF-11361362-11360424, MOR111-1
MMRRC Submission 038572-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0366 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location129677683-129688169 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129681971 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 256 (M256T)
Ref Sequence ENSEMBL: ENSMUSP00000150123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074713] [ENSMUST00000203785] [ENSMUST00000217576]
Predicted Effect probably benign
Transcript: ENSMUST00000074713
AA Change: M256T

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000074275
Gene: ENSMUSG00000093866
AA Change: M256T

DomainStartEndE-ValueType
Pfam:7tm_4 28 305 6.8e-56 PFAM
Pfam:7tm_1 39 288 2.5e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000203785
AA Change: M256T

PolyPhen 2 Score 0.721 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000144741
Gene: ENSMUSG00000093866
AA Change: M256T

DomainStartEndE-ValueType
Pfam:7tm_4 28 305 6.8e-56 PFAM
Pfam:7tm_1 39 288 2.5e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000217576
AA Change: M256T

PolyPhen 2 Score 0.721 (Sensitivity: 0.86; Specificity: 0.92)
Meta Mutation Damage Score 0.256 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 G T 17: 46,324,798 S93* probably null Het
Ackr2 T C 9: 121,909,360 L267P probably damaging Het
Adgre4 T A 17: 55,792,001 L169* probably null Het
AI481877 A C 4: 59,099,410 M94R probably benign Het
Ankrd12 T A 17: 65,984,506 S1311C possibly damaging Het
Arid2 T A 15: 96,361,720 probably benign Het
Atp9b A T 18: 80,762,102 V747E probably damaging Het
Best1 T C 19: 9,992,053 probably null Het
Brwd1 C A 16: 96,037,964 E836* probably null Het
Cachd1 A G 4: 100,994,737 S1177G possibly damaging Het
Cacna1e C T 1: 154,416,138 E1766K probably benign Het
Cckar A G 5: 53,700,165 I301T probably benign Het
Cdc27 T G 11: 104,505,648 T816P probably damaging Het
Cep162 T G 9: 87,220,484 Q708H probably damaging Het
Cep250 C A 2: 155,988,401 D1301E probably benign Het
D430041D05Rik G A 2: 104,255,340 H955Y probably damaging Het
Dcdc2a T A 13: 25,056,434 V55E probably damaging Het
Efcab12 A G 6: 115,823,248 probably benign Het
Ep400 A G 5: 110,701,671 V1428A unknown Het
Erbb3 T C 10: 128,572,570 E825G possibly damaging Het
Evl A T 12: 108,686,048 probably null Het
Fuca2 G A 10: 13,505,763 R140H probably benign Het
Gm4969 T A 7: 19,107,039 I57F probably damaging Het
Gm5581 T C 6: 131,166,447 noncoding transcript Het
Gm7052 T C 17: 22,040,517 probably benign Het
Gpd1 T G 15: 99,719,270 I119S probably damaging Het
Gzmc A T 14: 56,232,736 Y101* probably null Het
Hmcn2 G T 2: 31,424,206 A3588S possibly damaging Het
Ikbkb A G 8: 22,695,260 probably benign Het
Itgax G T 7: 128,149,089 probably benign Het
Kif24 C A 4: 41,428,717 S81I possibly damaging Het
Lct G A 1: 128,286,462 P1858S probably benign Het
Map2k1 C A 9: 64,193,702 probably null Het
Mdga1 A G 17: 29,857,708 V30A possibly damaging Het
Mtcl1 G A 17: 66,338,129 P1441L probably damaging Het
N4bp2 T A 5: 65,806,396 F596Y possibly damaging Het
Notch4 A T 17: 34,581,499 probably benign Het
Olfr1061 A G 2: 86,414,025 V9A possibly damaging Het
Olfr1259 A C 2: 89,943,818 V99G possibly damaging Het
Olfr167 A G 16: 19,514,848 S263P probably benign Het
Olfr907 T A 9: 38,499,154 C162S possibly damaging Het
Pbld2 A G 10: 63,053,957 probably benign Het
Phip T C 9: 82,926,407 Y505C probably damaging Het
Plcb2 A G 2: 118,724,447 F58L probably benign Het
Plcd1 T A 9: 119,081,136 I72F probably damaging Het
Ppp5c A T 7: 17,022,583 Y63* probably null Het
Prdm4 T C 10: 85,908,004 D129G probably damaging Het
Prkcq C A 2: 11,246,838 probably benign Het
Rab5b C T 10: 128,682,903 R120Q probably benign Het
Rab7b T A 1: 131,698,504 V90D probably damaging Het
Ripk3 T C 14: 55,786,835 T193A probably damaging Het
Rnf167 C T 11: 70,649,317 R88* probably null Het
Robo1 A G 16: 72,742,245 T59A possibly damaging Het
Scd2 G A 19: 44,301,246 V227I probably benign Het
Scg3 T A 9: 75,675,338 probably benign Het
Sec31a A T 5: 100,382,766 L677H probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Setd7 T C 3: 51,550,320 T29A probably benign Het
Slc4a5 A G 6: 83,295,872 Y942C probably benign Het
Slit1 T A 19: 41,611,031 Y1027F probably damaging Het
Sptan1 G A 2: 29,992,752 probably null Het
Tdrd12 T C 7: 35,508,802 Q249R probably benign Het
Tmem171 T A 13: 98,692,228 D138V possibly damaging Het
Ttll10 G A 4: 156,035,155 R596W probably damaging Het
Usp53 G T 3: 122,949,201 N695K probably damaging Het
Vmn2r25 A T 6: 123,823,622 L587* probably null Het
Zglp1 C T 9: 21,063,379 C171Y probably benign Het
Other mutations in Olfr802
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02939:Olfr802 APN 10 129681988 nonsense probably null
IGL03112:Olfr802 APN 10 129681923 missense probably benign 0.08
R0463:Olfr802 UTSW 10 129681839 missense probably benign 0.11
R0579:Olfr802 UTSW 10 129682237 nonsense probably null
R1769:Olfr802 UTSW 10 129682212 missense probably benign 0.15
R2128:Olfr802 UTSW 10 129682532 missense possibly damaging 0.78
R2375:Olfr802 UTSW 10 129682163 missense probably benign 0.04
R3888:Olfr802 UTSW 10 129682218 missense possibly damaging 0.94
R3888:Olfr802 UTSW 10 129682219 missense probably benign 0.43
R4956:Olfr802 UTSW 10 129682099 missense probably benign 0.00
R5471:Olfr802 UTSW 10 129682056 missense probably damaging 1.00
R5588:Olfr802 UTSW 10 129681836 missense possibly damaging 0.72
R7305:Olfr802 UTSW 10 129682280 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCCTTCAACGTACCTCTCATTCACAG -3'
(R):5'- ATCTGCAAGCCCCTGCATTACCTGAC -3'

Sequencing Primer
(F):5'- GTCCATTTCATTTACTTGTGGAAAAC -3'
(R):5'- CTATCATGAGTCAGAAGGTCTGC -3'
Posted On2013-05-09