Incidental Mutation 'R0366:Dcdc2a'
ID36433
Institutional Source Beutler Lab
Gene Symbol Dcdc2a
Ensembl Gene ENSMUSG00000035910
Gene Namedoublecortin domain containing 2a
SynonymsRU2, Dcdc2
MMRRC Submission 038572-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.242) question?
Stock #R0366 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location25056004-25210706 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 25056434 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 55 (V55E)
Ref Sequence ENSEMBL: ENSMUSP00000047641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036932] [ENSMUST00000069614]
Predicted Effect probably damaging
Transcript: ENSMUST00000036932
AA Change: V55E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000047641
Gene: ENSMUSG00000035910
AA Change: V55E

DomainStartEndE-ValueType
DCX 12 100 2.93e-40 SMART
DCX 134 221 1.76e-34 SMART
low complexity region 286 299 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000069614
AA Change: V55E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000063650
Gene: ENSMUSG00000035910
AA Change: V55E

DomainStartEndE-ValueType
DCX 12 100 2.93e-40 SMART
DCX 134 221 1.76e-34 SMART
low complexity region 286 299 N/A INTRINSIC
low complexity region 325 340 N/A INTRINSIC
coiled coil region 409 437 N/A INTRINSIC
low complexity region 461 475 N/A INTRINSIC
Meta Mutation Damage Score 0.0284 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: This gene encodes a member of the doublecortin family. The protein encoded by this gene contains two doublecortin domains. The doublecortin domain has been demonstrated to bind tubulin and enhance microtubule polymerization. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired short term object recognition, impaired visuo-spatial learning and memory and increased anxiety-related response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 G T 17: 46,324,798 S93* probably null Het
Ackr2 T C 9: 121,909,360 L267P probably damaging Het
Adgre4 T A 17: 55,792,001 L169* probably null Het
AI481877 A C 4: 59,099,410 M94R probably benign Het
Ankrd12 T A 17: 65,984,506 S1311C possibly damaging Het
Arid2 T A 15: 96,361,720 probably benign Het
Atp9b A T 18: 80,762,102 V747E probably damaging Het
Best1 T C 19: 9,992,053 probably null Het
Brwd1 C A 16: 96,037,964 E836* probably null Het
Cachd1 A G 4: 100,994,737 S1177G possibly damaging Het
Cacna1e C T 1: 154,416,138 E1766K probably benign Het
Cckar A G 5: 53,700,165 I301T probably benign Het
Cdc27 T G 11: 104,505,648 T816P probably damaging Het
Cep162 T G 9: 87,220,484 Q708H probably damaging Het
Cep250 C A 2: 155,988,401 D1301E probably benign Het
D430041D05Rik G A 2: 104,255,340 H955Y probably damaging Het
Efcab12 A G 6: 115,823,248 probably benign Het
Ep400 A G 5: 110,701,671 V1428A unknown Het
Erbb3 T C 10: 128,572,570 E825G possibly damaging Het
Evl A T 12: 108,686,048 probably null Het
Fuca2 G A 10: 13,505,763 R140H probably benign Het
Gm4969 T A 7: 19,107,039 I57F probably damaging Het
Gm5581 T C 6: 131,166,447 noncoding transcript Het
Gm7052 T C 17: 22,040,517 probably benign Het
Gpd1 T G 15: 99,719,270 I119S probably damaging Het
Gzmc A T 14: 56,232,736 Y101* probably null Het
Hmcn2 G T 2: 31,424,206 A3588S possibly damaging Het
Ikbkb A G 8: 22,695,260 probably benign Het
Itgax G T 7: 128,149,089 probably benign Het
Kif24 C A 4: 41,428,717 S81I possibly damaging Het
Lct G A 1: 128,286,462 P1858S probably benign Het
Map2k1 C A 9: 64,193,702 probably null Het
Mdga1 A G 17: 29,857,708 V30A possibly damaging Het
Mtcl1 G A 17: 66,338,129 P1441L probably damaging Het
N4bp2 T A 5: 65,806,396 F596Y possibly damaging Het
Notch4 A T 17: 34,581,499 probably benign Het
Olfr1061 A G 2: 86,414,025 V9A possibly damaging Het
Olfr1259 A C 2: 89,943,818 V99G possibly damaging Het
Olfr167 A G 16: 19,514,848 S263P probably benign Het
Olfr802 A G 10: 129,681,971 M256T possibly damaging Het
Olfr907 T A 9: 38,499,154 C162S possibly damaging Het
Pbld2 A G 10: 63,053,957 probably benign Het
Phip T C 9: 82,926,407 Y505C probably damaging Het
Plcb2 A G 2: 118,724,447 F58L probably benign Het
Plcd1 T A 9: 119,081,136 I72F probably damaging Het
Ppp5c A T 7: 17,022,583 Y63* probably null Het
Prdm4 T C 10: 85,908,004 D129G probably damaging Het
Prkcq C A 2: 11,246,838 probably benign Het
Rab5b C T 10: 128,682,903 R120Q probably benign Het
Rab7b T A 1: 131,698,504 V90D probably damaging Het
Ripk3 T C 14: 55,786,835 T193A probably damaging Het
Rnf167 C T 11: 70,649,317 R88* probably null Het
Robo1 A G 16: 72,742,245 T59A possibly damaging Het
Scd2 G A 19: 44,301,246 V227I probably benign Het
Scg3 T A 9: 75,675,338 probably benign Het
Sec31a A T 5: 100,382,766 L677H probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Setd7 T C 3: 51,550,320 T29A probably benign Het
Slc4a5 A G 6: 83,295,872 Y942C probably benign Het
Slit1 T A 19: 41,611,031 Y1027F probably damaging Het
Sptan1 G A 2: 29,992,752 probably null Het
Tdrd12 T C 7: 35,508,802 Q249R probably benign Het
Tmem171 T A 13: 98,692,228 D138V possibly damaging Het
Ttll10 G A 4: 156,035,155 R596W probably damaging Het
Usp53 G T 3: 122,949,201 N695K probably damaging Het
Vmn2r25 A T 6: 123,823,622 L587* probably null Het
Zglp1 C T 9: 21,063,379 C171Y probably benign Het
Other mutations in Dcdc2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Dcdc2a APN 13 25119329 missense probably benign 0.00
IGL01314:Dcdc2a APN 13 25102604 missense probably damaging 1.00
IGL02171:Dcdc2a APN 13 25056434 missense probably damaging 1.00
IGL02490:Dcdc2a APN 13 25107652 missense probably damaging 1.00
R0128:Dcdc2a UTSW 13 25187672 splice site probably benign
R0130:Dcdc2a UTSW 13 25187672 splice site probably benign
R0507:Dcdc2a UTSW 13 25102589 missense probably damaging 0.99
R0514:Dcdc2a UTSW 13 25119386 missense probably benign 0.04
R1055:Dcdc2a UTSW 13 25102610 missense probably damaging 0.99
R1170:Dcdc2a UTSW 13 25056307 missense probably benign 0.34
R1301:Dcdc2a UTSW 13 25102586 missense possibly damaging 0.93
R1514:Dcdc2a UTSW 13 25061254 missense probably benign 0.05
R1842:Dcdc2a UTSW 13 25107602 missense probably damaging 1.00
R2060:Dcdc2a UTSW 13 25107710 missense possibly damaging 0.59
R2121:Dcdc2a UTSW 13 25119285 missense possibly damaging 0.93
R2122:Dcdc2a UTSW 13 25119285 missense possibly damaging 0.93
R2900:Dcdc2a UTSW 13 25120498 missense probably benign 0.01
R3153:Dcdc2a UTSW 13 25102357 missense probably benign 0.03
R3154:Dcdc2a UTSW 13 25102357 missense probably benign 0.03
R4353:Dcdc2a UTSW 13 25056491 missense probably damaging 1.00
R4608:Dcdc2a UTSW 13 25061240 nonsense probably null
R5099:Dcdc2a UTSW 13 25107698 missense probably benign 0.12
R5128:Dcdc2a UTSW 13 25102529 missense probably damaging 1.00
R5181:Dcdc2a UTSW 13 25202364 missense possibly damaging 0.94
R5271:Dcdc2a UTSW 13 25187688 missense probably benign 0.35
R5869:Dcdc2a UTSW 13 25107730 missense probably benign 0.05
R6058:Dcdc2a UTSW 13 25056371 missense possibly damaging 0.82
R6146:Dcdc2a UTSW 13 25205457 missense probably benign 0.35
R6892:Dcdc2a UTSW 13 25056460 missense probably damaging 1.00
R6956:Dcdc2a UTSW 13 25119366 missense probably benign 0.02
R6972:Dcdc2a UTSW 13 25120389 intron probably benign
R6973:Dcdc2a UTSW 13 25120389 intron probably benign
R7097:Dcdc2a UTSW 13 25107698 missense probably benign 0.12
R7247:Dcdc2a UTSW 13 25102391 missense probably benign 0.00
R7390:Dcdc2a UTSW 13 25107617 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CTTGAATTGCTACCTGCTAGGGCTG -3'
(R):5'- GAGGTTGCCTCCTATCAACCACAC -3'

Sequencing Primer
(F):5'- TCCACGAGCTGCTGTTG -3'
(R):5'- TATCAACCACACCCCACAGAG -3'
Posted On2013-05-09