Incidental Mutation 'R0378:Duox2'
ID36456
Institutional Source Beutler Lab
Gene Symbol Duox2
Ensembl Gene ENSMUSG00000068452
Gene Namedual oxidase 2
SynonymsA430065P05Rik
MMRRC Submission 038584-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0378 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location122279247-122298165 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 122284583 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 1138 (V1138L)
Ref Sequence ENSEMBL: ENSMUSP00000050314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053734]
Predicted Effect probably benign
Transcript: ENSMUST00000053734
AA Change: V1138L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000050314
Gene: ENSMUSG00000068452
AA Change: V1138L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:An_peroxidase 35 560 5e-131 PFAM
transmembrane domain 600 622 N/A INTRINSIC
EFh 823 851 3.7e-5 SMART
EFh 859 887 2.09e-4 SMART
transmembrane domain 1010 1032 N/A INTRINSIC
Pfam:Ferric_reduct 1053 1202 1.8e-22 PFAM
Pfam:FAD_binding_8 1238 1340 3.1e-20 PFAM
Pfam:NAD_binding_6 1346 1500 1.5e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155820
Meta Mutation Damage Score 0.032 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycoprotein and a member of the NADPH oxidase family. The synthesis of thyroid hormone is catalyzed by a protein complex located at the apical membrane of thyroid follicular cells. This complex contains an iodide transporter, thyroperoxidase, and a peroxide generating system that includes this encoded protein and DUOX1. This protein is known as dual oxidase because it has both a peroxidase homology domain and a gp91phox domain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous mutation fail to breed and are congenitally hypothyroid (low T4, high TSH), dwarf, and hearing impaired. Anterior pituitaries are dysplastic. Cochlear defects include delayed formation of the inner sulcus and tunnel of Corti and a thickened tectorial membrane. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 C A 8: 113,743,117 R651L probably damaging Het
Amd1 T C 10: 40,289,384 D317G possibly damaging Het
Artn A G 4: 117,927,618 probably benign Het
Asna1 A T 8: 85,025,264 M1K probably null Het
Bub1b T A 2: 118,641,123 V988E probably benign Het
Cyp2c65 G T 19: 39,073,218 C216F probably benign Het
Cyp3a11 T C 5: 145,868,607 E200G probably benign Het
Cyp3a25 T A 5: 145,986,842 K330N probably damaging Het
Erc2 A G 14: 28,011,694 D567G probably damaging Het
Eri2 A G 7: 119,793,916 probably null Het
Foxa3 A G 7: 19,023,369 Y17H probably damaging Het
Fto T C 8: 91,474,312 S324P probably damaging Het
Gls2 T G 10: 128,207,311 L457R probably benign Het
Gstcd A T 3: 132,986,408 L582H probably damaging Het
Gtf3c1 G A 7: 125,647,614 R1508* probably null Het
Kif21a T C 15: 90,969,774 probably null Het
Klra5 A T 6: 129,906,614 D93E possibly damaging Het
Lgr5 T C 10: 115,454,499 D456G probably damaging Het
Mau2 A G 8: 70,030,655 S186P probably damaging Het
Msr1 T C 8: 39,589,382 D384G possibly damaging Het
Mum1 C A 10: 80,238,879 probably null Het
Ncf4 T C 15: 78,253,303 V93A probably damaging Het
Oas1f T G 5: 120,856,426 C337G probably damaging Het
Olfr119 A G 17: 37,701,041 M124V probably damaging Het
Olfr482 A T 7: 108,095,222 F116Y probably benign Het
Olfr820 T A 10: 130,018,003 L214H probably damaging Het
Rasl10b T C 11: 83,418,693 S159P probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Smg8 C A 11: 87,080,423 D841Y probably damaging Het
Sox7 T C 14: 63,943,949 V65A probably damaging Het
Sp140 C T 1: 85,620,051 probably benign Het
Srsf10 A G 4: 135,863,190 Y142C possibly damaging Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tcerg1l A G 7: 138,276,655 V326A probably benign Het
Tcl1b5 T A 12: 105,179,067 W97R probably damaging Het
Tmem108 T C 9: 103,499,657 R198G possibly damaging Het
Ube2ql1 T A 13: 69,738,898 Q148L possibly damaging Het
Vmn1r5 A T 6: 56,985,585 I82L probably benign Het
Wdr6 A T 9: 108,575,864 S273R probably damaging Het
Ylpm1 C T 12: 84,997,076 probably benign Het
Zfp90 G A 8: 106,425,506 R617Q possibly damaging Het
Other mutations in Duox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00474:Duox2 APN 2 122283575 missense probably benign
IGL00790:Duox2 APN 2 122292300 missense possibly damaging 0.63
IGL01346:Duox2 APN 2 122287202 splice site probably benign
IGL01607:Duox2 APN 2 122292319 missense probably benign 0.00
IGL01798:Duox2 APN 2 122281908 missense probably damaging 1.00
IGL02000:Duox2 APN 2 122290709 missense probably benign
IGL02219:Duox2 APN 2 122294664 missense probably benign 0.01
IGL02227:Duox2 APN 2 122285153 splice site probably benign
IGL02276:Duox2 APN 2 122294085 missense probably benign 0.00
IGL02447:Duox2 APN 2 122297468 missense probably damaging 0.98
IGL02806:Duox2 APN 2 122284666 missense probably damaging 1.00
IGL03091:Duox2 APN 2 122289474 missense probably benign 0.03
Bedazzled UTSW 2 122287121 missense possibly damaging 0.76
Immunox UTSW 2 122281871 missense probably benign
minor UTSW 2 122281496 missense probably damaging 1.00
paltry UTSW 2 122283060 critical splice donor site probably null
Recruit UTSW 2 122283897 missense possibly damaging 0.83
stumblebum UTSW 2 122284667 missense probably damaging 1.00
Two-bit UTSW 2 122281002 missense probably benign 0.42
R0049:Duox2 UTSW 2 122296686 missense possibly damaging 0.48
R0244:Duox2 UTSW 2 122291860 missense probably benign 0.00
R0281:Duox2 UTSW 2 122292304 missense probably benign 0.10
R0383:Duox2 UTSW 2 122291810 critical splice donor site probably null
R0442:Duox2 UTSW 2 122289332 missense probably benign 0.08
R0524:Duox2 UTSW 2 122281836 missense possibly damaging 0.80
R0560:Duox2 UTSW 2 122291554 missense probably benign 0.04
R0562:Duox2 UTSW 2 122289599 missense probably damaging 1.00
R0645:Duox2 UTSW 2 122292658 missense probably damaging 1.00
R0704:Duox2 UTSW 2 122284768 missense probably benign 0.01
R0963:Duox2 UTSW 2 122287172 missense probably benign 0.03
R1254:Duox2 UTSW 2 122283478 missense probably damaging 1.00
R1442:Duox2 UTSW 2 122281751 missense probably benign 0.20
R1473:Duox2 UTSW 2 122287121 missense possibly damaging 0.76
R1489:Duox2 UTSW 2 122293396 missense probably benign
R1738:Duox2 UTSW 2 122293414 missense probably damaging 1.00
R1748:Duox2 UTSW 2 122287051 missense probably benign 0.00
R1809:Duox2 UTSW 2 122283897 missense possibly damaging 0.83
R1843:Duox2 UTSW 2 122292258 critical splice donor site probably null
R1903:Duox2 UTSW 2 122295351 missense probably damaging 1.00
R1962:Duox2 UTSW 2 122297372 splice site probably null
R2069:Duox2 UTSW 2 122287108 missense probably benign 0.01
R2073:Duox2 UTSW 2 122295158 missense probably damaging 1.00
R2074:Duox2 UTSW 2 122295158 missense probably damaging 1.00
R2075:Duox2 UTSW 2 122295158 missense probably damaging 1.00
R2085:Duox2 UTSW 2 122280967 missense probably damaging 1.00
R3123:Duox2 UTSW 2 122281073 splice site probably benign
R3907:Duox2 UTSW 2 122283060 critical splice donor site probably null
R4572:Duox2 UTSW 2 122281726 missense probably benign 0.00
R4614:Duox2 UTSW 2 122289557 missense probably damaging 1.00
R4675:Duox2 UTSW 2 122280933 missense probably damaging 1.00
R4770:Duox2 UTSW 2 122284916 missense probably benign 0.01
R4817:Duox2 UTSW 2 122296515 missense probably damaging 0.98
R4931:Duox2 UTSW 2 122296755 missense probably benign 0.01
R5138:Duox2 UTSW 2 122297531 missense probably damaging 1.00
R5288:Duox2 UTSW 2 122295136 missense probably benign
R5344:Duox2 UTSW 2 122281871 missense probably benign
R5385:Duox2 UTSW 2 122295136 missense probably benign
R5386:Duox2 UTSW 2 122295136 missense probably benign
R5493:Duox2 UTSW 2 122281496 missense probably damaging 1.00
R5632:Duox2 UTSW 2 122281455 missense probably damaging 1.00
R5742:Duox2 UTSW 2 122284921 missense probably benign 0.00
R6228:Duox2 UTSW 2 122287193 missense probably benign 0.38
R6380:Duox2 UTSW 2 122281002 missense probably benign 0.42
R6398:Duox2 UTSW 2 122296370 missense probably benign 0.06
R6409:Duox2 UTSW 2 122284667 missense probably damaging 1.00
R6527:Duox2 UTSW 2 122294614 missense probably benign 0.29
R6596:Duox2 UTSW 2 122285338 missense probably benign
R6719:Duox2 UTSW 2 122284386 intron probably null
R6981:Duox2 UTSW 2 122291227 missense possibly damaging 0.95
R7036:Duox2 UTSW 2 122280453 missense probably damaging 1.00
R7073:Duox2 UTSW 2 122289307 missense probably damaging 1.00
R7105:Duox2 UTSW 2 122289552 missense possibly damaging 0.93
R7127:Duox2 UTSW 2 122291949 missense probably benign 0.02
R7259:Duox2 UTSW 2 122295176 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACCTTACAGCTTCTCCATGAGGGAC -3'
(R):5'- CAGACTATGGCTTTGCCTCACCAC -3'

Sequencing Primer
(F):5'- TTCTCCATGAGGGACAGAGC -3'
(R):5'- ATGCCGCTGTGGACTTC -3'
Posted On2013-05-09