Incidental Mutation 'R0378:Gstcd'
ID36457
Institutional Source Beutler Lab
Gene Symbol Gstcd
Ensembl Gene ENSMUSG00000028018
Gene Nameglutathione S-transferase, C-terminal domain containing
Synonyms
MMRRC Submission 038584-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0378 (G1)
Quality Score83
Status Validated
Chromosome3
Chromosomal Location132981752-133092033 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 132986408 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 582 (L582H)
Ref Sequence ENSEMBL: ENSMUSP00000079421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029651] [ENSMUST00000080583]
Predicted Effect probably damaging
Transcript: ENSMUST00000029651
AA Change: L582H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029651
Gene: ENSMUSG00000028018
AA Change: L582H

DomainStartEndE-ValueType
low complexity region 52 62 N/A INTRINSIC
low complexity region 168 181 N/A INTRINSIC
low complexity region 195 205 N/A INTRINSIC
low complexity region 208 229 N/A INTRINSIC
Pfam:GidB 417 515 9e-9 PFAM
Pfam:Methyltransf_32 424 548 1.1e-15 PFAM
Pfam:MTS 430 508 5.3e-6 PFAM
Pfam:Methyltransf_31 440 571 2.6e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000080583
AA Change: L582H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079421
Gene: ENSMUSG00000028018
AA Change: L582H

DomainStartEndE-ValueType
low complexity region 52 62 N/A INTRINSIC
low complexity region 168 181 N/A INTRINSIC
low complexity region 195 205 N/A INTRINSIC
low complexity region 208 229 N/A INTRINSIC
Pfam:GidB 418 516 1.5e-8 PFAM
Pfam:Methyltransf_32 424 548 1.1e-15 PFAM
Pfam:Methyltransf_31 440 569 2.5e-11 PFAM
Meta Mutation Damage Score 0.346 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 95% (40/42)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 C A 8: 113,743,117 R651L probably damaging Het
Amd1 T C 10: 40,289,384 D317G possibly damaging Het
Artn A G 4: 117,927,618 probably benign Het
Asna1 A T 8: 85,025,264 M1K probably null Het
Bub1b T A 2: 118,641,123 V988E probably benign Het
Cyp2c65 G T 19: 39,073,218 C216F probably benign Het
Cyp3a11 T C 5: 145,868,607 E200G probably benign Het
Cyp3a25 T A 5: 145,986,842 K330N probably damaging Het
Duox2 C A 2: 122,284,583 V1138L probably benign Het
Erc2 A G 14: 28,011,694 D567G probably damaging Het
Eri2 A G 7: 119,793,916 probably null Het
Foxa3 A G 7: 19,023,369 Y17H probably damaging Het
Fto T C 8: 91,474,312 S324P probably damaging Het
Gls2 T G 10: 128,207,311 L457R probably benign Het
Gtf3c1 G A 7: 125,647,614 R1508* probably null Het
Kif21a T C 15: 90,969,774 probably null Het
Klra5 A T 6: 129,906,614 D93E possibly damaging Het
Lgr5 T C 10: 115,454,499 D456G probably damaging Het
Mau2 A G 8: 70,030,655 S186P probably damaging Het
Msr1 T C 8: 39,589,382 D384G possibly damaging Het
Mum1 C A 10: 80,238,879 probably null Het
Ncf4 T C 15: 78,253,303 V93A probably damaging Het
Oas1f T G 5: 120,856,426 C337G probably damaging Het
Olfr119 A G 17: 37,701,041 M124V probably damaging Het
Olfr482 A T 7: 108,095,222 F116Y probably benign Het
Olfr820 T A 10: 130,018,003 L214H probably damaging Het
Rasl10b T C 11: 83,418,693 S159P probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Smg8 C A 11: 87,080,423 D841Y probably damaging Het
Sox7 T C 14: 63,943,949 V65A probably damaging Het
Sp140 C T 1: 85,620,051 probably benign Het
Srsf10 A G 4: 135,863,190 Y142C possibly damaging Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tcerg1l A G 7: 138,276,655 V326A probably benign Het
Tcl1b5 T A 12: 105,179,067 W97R probably damaging Het
Tmem108 T C 9: 103,499,657 R198G possibly damaging Het
Ube2ql1 T A 13: 69,738,898 Q148L possibly damaging Het
Vmn1r5 A T 6: 56,985,585 I82L probably benign Het
Wdr6 A T 9: 108,575,864 S273R probably damaging Het
Ylpm1 C T 12: 84,997,076 probably benign Het
Zfp90 G A 8: 106,425,506 R617Q possibly damaging Het
Other mutations in Gstcd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01540:Gstcd APN 3 132986414 missense probably damaging 0.96
IGL01800:Gstcd APN 3 133084574 critical splice donor site probably null
IGL02434:Gstcd APN 3 132996202 splice site probably benign
IGL02720:Gstcd APN 3 133071961 missense probably benign 0.00
R0367:Gstcd UTSW 3 132986377 splice site probably benign
R0382:Gstcd UTSW 3 132986408 missense probably damaging 1.00
R0465:Gstcd UTSW 3 132983144 missense probably benign 0.04
R1295:Gstcd UTSW 3 133005628 missense probably damaging 1.00
R1861:Gstcd UTSW 3 132983107 missense probably damaging 1.00
R2056:Gstcd UTSW 3 133082053 missense probably benign 0.00
R2331:Gstcd UTSW 3 132998880 missense probably damaging 0.98
R2513:Gstcd UTSW 3 133082320 missense possibly damaging 0.59
R2513:Gstcd UTSW 3 133082321 missense possibly damaging 0.87
R3547:Gstcd UTSW 3 133084838 missense possibly damaging 0.86
R4022:Gstcd UTSW 3 133082068 missense probably damaging 1.00
R4713:Gstcd UTSW 3 132983099 missense probably damaging 1.00
R4877:Gstcd UTSW 3 133005553 splice site probably benign
R5152:Gstcd UTSW 3 133084956 missense possibly damaging 0.95
R5165:Gstcd UTSW 3 133084679 missense probably damaging 0.99
R6106:Gstcd UTSW 3 132998914 missense probably benign 0.02
R6177:Gstcd UTSW 3 133082073 missense probably damaging 1.00
R7100:Gstcd UTSW 3 133084943 missense probably benign 0.01
R7264:Gstcd UTSW 3 133084779 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTCAGTCATAATGGCTAATGTGCTGC -3'
(R):5'- CAGTCAACTTGACGGGAAGAAGTCAC -3'

Sequencing Primer
(F):5'- GCTAATGTGCTGCATTACAGTTC -3'
(R):5'- AGGATTGCTCTTTTCAGCTACTC -3'
Posted On2013-05-09