Incidental Mutation 'R0378:Asna1'
ID36471
Institutional Source Beutler Lab
Gene Symbol Asna1
Ensembl Gene ENSMUSG00000052456
Gene NamearsA arsenite transporter, ATP-binding, homolog 1 (bacterial)
SynonymsArsA, 1810048H22Rik
MMRRC Submission 038584-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0378 (G1)
Quality Score196
Status Not validated
Chromosome8
Chromosomal Location85017931-85025281 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 85025264 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000065337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047281] [ENSMUST00000064314]
Predicted Effect probably benign
Transcript: ENSMUST00000047281
SMART Domains Protein: ENSMUSP00000044129
Gene: ENSMUSG00000041203

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
low complexity region 34 52 N/A INTRINSIC
low complexity region 70 108 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000064314
AA Change: M1K
SMART Domains Protein: ENSMUSP00000065337
Gene: ENSMUSG00000052456
AA Change: M1K

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:ArsA_ATPase 37 340 2.2e-127 PFAM
Pfam:CbiA 39 311 5.7e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000209834
AA Change: M1K
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211221
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211702
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene represents the human homolog of the bacterial arsA gene, encoding the arsenite-stimulated ATPase component of the arsenite transporter responsible for resistance to arsenicals. This protein is also a central component of a transmembrane domain (TMD) recognition complex (TRC) that is involved in the post-translational delivery of tail-anchored (TA) proteins from the cytosol to the endoplasmic reticulum (ER). It recognizes and selectively binds the TMD of TA proteins in the cytosol, and delivers them to the ER for insertion. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a null mutation display early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 C A 8: 113,743,117 R651L probably damaging Het
Amd1 T C 10: 40,289,384 D317G possibly damaging Het
Artn A G 4: 117,927,618 probably benign Het
Bub1b T A 2: 118,641,123 V988E probably benign Het
Cyp2c65 G T 19: 39,073,218 C216F probably benign Het
Cyp3a11 T C 5: 145,868,607 E200G probably benign Het
Cyp3a25 T A 5: 145,986,842 K330N probably damaging Het
Duox2 C A 2: 122,284,583 V1138L probably benign Het
Erc2 A G 14: 28,011,694 D567G probably damaging Het
Eri2 A G 7: 119,793,916 probably null Het
Foxa3 A G 7: 19,023,369 Y17H probably damaging Het
Fto T C 8: 91,474,312 S324P probably damaging Het
Gls2 T G 10: 128,207,311 L457R probably benign Het
Gstcd A T 3: 132,986,408 L582H probably damaging Het
Gtf3c1 G A 7: 125,647,614 R1508* probably null Het
Kif21a T C 15: 90,969,774 probably null Het
Klra5 A T 6: 129,906,614 D93E possibly damaging Het
Lgr5 T C 10: 115,454,499 D456G probably damaging Het
Mau2 A G 8: 70,030,655 S186P probably damaging Het
Msr1 T C 8: 39,589,382 D384G possibly damaging Het
Mum1 C A 10: 80,238,879 probably null Het
Ncf4 T C 15: 78,253,303 V93A probably damaging Het
Oas1f T G 5: 120,856,426 C337G probably damaging Het
Olfr119 A G 17: 37,701,041 M124V probably damaging Het
Olfr482 A T 7: 108,095,222 F116Y probably benign Het
Olfr820 T A 10: 130,018,003 L214H probably damaging Het
Rasl10b T C 11: 83,418,693 S159P probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Smg8 C A 11: 87,080,423 D841Y probably damaging Het
Sox7 T C 14: 63,943,949 V65A probably damaging Het
Sp140 C T 1: 85,620,051 probably benign Het
Srsf10 A G 4: 135,863,190 Y142C possibly damaging Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tcerg1l A G 7: 138,276,655 V326A probably benign Het
Tcl1b5 T A 12: 105,179,067 W97R probably damaging Het
Tmem108 T C 9: 103,499,657 R198G possibly damaging Het
Ube2ql1 T A 13: 69,738,898 Q148L possibly damaging Het
Vmn1r5 A T 6: 56,985,585 I82L probably benign Het
Wdr6 A T 9: 108,575,864 S273R probably damaging Het
Ylpm1 C T 12: 84,997,076 probably benign Het
Zfp90 G A 8: 106,425,506 R617Q possibly damaging Het
Other mutations in Asna1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01992:Asna1 APN 8 85018556 missense possibly damaging 0.64
R0012:Asna1 UTSW 8 85025096 splice site probably benign
R0504:Asna1 UTSW 8 85018607 missense probably damaging 1.00
R1188:Asna1 UTSW 8 85019793 missense probably damaging 1.00
R2001:Asna1 UTSW 8 85025160 missense probably damaging 0.96
R2029:Asna1 UTSW 8 85019774 nonsense probably null
R2264:Asna1 UTSW 8 85025258 unclassified probably benign
R2511:Asna1 UTSW 8 85019766 missense possibly damaging 0.79
R4676:Asna1 UTSW 8 85018873 missense probably benign 0.01
R5401:Asna1 UTSW 8 85018544 missense possibly damaging 0.56
R6465:Asna1 UTSW 8 85018565 missense probably benign 0.01
R7378:Asna1 UTSW 8 85019863 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- TTTGGTCCAGTGGTACATCCCACC -3'
(R):5'- GCCCAATCAGTGAAGAGCAGTAGTC -3'

Sequencing Primer
(F):5'- GGTACATCCCACCCGTCC -3'
(R):5'- TTCACAAAGGTGAGCCCTTG -3'
Posted On2013-05-09