Incidental Mutation 'R0378:Fto'
ID36472
Institutional Source Beutler Lab
Gene Symbol Fto
Ensembl Gene ENSMUSG00000055932
Gene Namefat mass and obesity associated
Synonyms
MMRRC Submission 038584-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0378 (G1)
Quality Score159
Status Validated
Chromosome8
Chromosomal Location91313525-91668439 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91474312 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 324 (S324P)
Ref Sequence ENSEMBL: ENSMUSP00000147603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069718] [ENSMUST00000128081] [ENSMUST00000136802]
Predicted Effect probably damaging
Transcript: ENSMUST00000069718
AA Change: S324P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068380
Gene: ENSMUSG00000055932
AA Change: S324P

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
FTO_NTD 35 323 2.71e-191 SMART
Pfam:FTO_CTD 326 495 1.1e-69 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000128081
AA Change: S324P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000136802
AA Change: S324P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140276
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211287
Meta Mutation Damage Score 0.14 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a nuclear protein of the AlkB related non-haem iron and 2-oxoglutarate-dependent oxygenase superfamily but the exact physiological function of this gene is not known. Other non-heme iron enzymes function to reverse alkylated DNA and RNA damage by oxidative demethylation. Studies in mice and humans indicate a role in nervous and cardiovascular systems and a strong association with body mass index, obesity risk, and type 2 diabetes. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for an ENU-induced or targeted knock-out allele exhibit decreased body weight, adipose tissue, and body fat and increased metabolism, serum lipids, and serum glucagon that may be gender and diet dependent. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 C A 8: 113,743,117 R651L probably damaging Het
Amd1 T C 10: 40,289,384 D317G possibly damaging Het
Artn A G 4: 117,927,618 probably benign Het
Asna1 A T 8: 85,025,264 M1K probably null Het
Bub1b T A 2: 118,641,123 V988E probably benign Het
Cyp2c65 G T 19: 39,073,218 C216F probably benign Het
Cyp3a11 T C 5: 145,868,607 E200G probably benign Het
Cyp3a25 T A 5: 145,986,842 K330N probably damaging Het
Duox2 C A 2: 122,284,583 V1138L probably benign Het
Erc2 A G 14: 28,011,694 D567G probably damaging Het
Eri2 A G 7: 119,793,916 probably null Het
Foxa3 A G 7: 19,023,369 Y17H probably damaging Het
Gls2 T G 10: 128,207,311 L457R probably benign Het
Gstcd A T 3: 132,986,408 L582H probably damaging Het
Gtf3c1 G A 7: 125,647,614 R1508* probably null Het
Kif21a T C 15: 90,969,774 probably null Het
Klra5 A T 6: 129,906,614 D93E possibly damaging Het
Lgr5 T C 10: 115,454,499 D456G probably damaging Het
Mau2 A G 8: 70,030,655 S186P probably damaging Het
Msr1 T C 8: 39,589,382 D384G possibly damaging Het
Mum1 C A 10: 80,238,879 probably null Het
Ncf4 T C 15: 78,253,303 V93A probably damaging Het
Oas1f T G 5: 120,856,426 C337G probably damaging Het
Olfr119 A G 17: 37,701,041 M124V probably damaging Het
Olfr482 A T 7: 108,095,222 F116Y probably benign Het
Olfr820 T A 10: 130,018,003 L214H probably damaging Het
Rasl10b T C 11: 83,418,693 S159P probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Smg8 C A 11: 87,080,423 D841Y probably damaging Het
Sox7 T C 14: 63,943,949 V65A probably damaging Het
Sp140 C T 1: 85,620,051 probably benign Het
Srsf10 A G 4: 135,863,190 Y142C possibly damaging Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tcerg1l A G 7: 138,276,655 V326A probably benign Het
Tcl1b5 T A 12: 105,179,067 W97R probably damaging Het
Tmem108 T C 9: 103,499,657 R198G possibly damaging Het
Ube2ql1 T A 13: 69,738,898 Q148L possibly damaging Het
Vmn1r5 A T 6: 56,985,585 I82L probably benign Het
Wdr6 A T 9: 108,575,864 S273R probably damaging Het
Ylpm1 C T 12: 84,997,076 probably benign Het
Zfp90 G A 8: 106,425,506 R617Q possibly damaging Het
Other mutations in Fto
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01458:Fto APN 8 91441716 missense probably benign 0.29
IGL01541:Fto APN 8 91409748 missense probably damaging 1.00
IGL01636:Fto APN 8 91409341 missense probably damaging 1.00
IGL01788:Fto APN 8 91409731 missense probably benign 0.25
IGL02016:Fto APN 8 91666406 nonsense probably null
IGL02365:Fto APN 8 91468375 missense probably damaging 1.00
IGL02639:Fto APN 8 91409528 missense probably damaging 1.00
IGL02926:Fto APN 8 91485167 missense probably damaging 1.00
IGL03194:Fto APN 8 91409787 missense probably damaging 1.00
R0091:Fto UTSW 8 91441807 critical splice donor site probably null
R0105:Fto UTSW 8 91522802 missense probably damaging 1.00
R0326:Fto UTSW 8 91409527 missense probably damaging 1.00
R0332:Fto UTSW 8 91401890 splice site probably benign
R0601:Fto UTSW 8 91401802 splice site probably null
R1526:Fto UTSW 8 91441686 missense possibly damaging 0.90
R2092:Fto UTSW 8 91409687 nonsense probably null
R4731:Fto UTSW 8 91409714 missense probably damaging 1.00
R4732:Fto UTSW 8 91409714 missense probably damaging 1.00
R4733:Fto UTSW 8 91409714 missense probably damaging 1.00
R5347:Fto UTSW 8 91391479 intron probably benign
R5840:Fto UTSW 8 91666440 utr 3 prime probably benign
Predicted Primers PCR Primer
(F):5'- CATATAGTGTAGACAGCCAGCAGCC -3'
(R):5'- CTGCAAGCAGGGATGAGTCTCAATC -3'

Sequencing Primer
(F):5'- CAGCCTGTATGACTGCTGAG -3'
(R):5'- CAGGGATGAGTCTCAATCTACGC -3'
Posted On2013-05-09