Incidental Mutation 'R0378:Gls2'
ID36479
Institutional Source Beutler Lab
Gene Symbol Gls2
Ensembl Gene ENSMUSG00000044005
Gene Nameglutaminase 2 (liver, mitochondrial)
SynonymsLga, A330074B06Rik
MMRRC Submission 038584-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0378 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location128194457-128210004 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 128207311 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 457 (L457R)
Ref Sequence ENSEMBL: ENSMUSP00000047376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044776] [ENSMUST00000061995] [ENSMUST00000143827] [ENSMUST00000159440]
Predicted Effect probably benign
Transcript: ENSMUST00000044776
AA Change: L457R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000047376
Gene: ENSMUSG00000044005
AA Change: L457R

DomainStartEndE-ValueType
Pfam:Glutaminase 177 463 1.1e-116 PFAM
ANK 518 548 3.76e-5 SMART
ANK 552 581 1.21e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000061995
SMART Domains Protein: ENSMUSP00000054731
Gene: ENSMUSG00000051346

DomainStartEndE-ValueType
Blast:PRY 29 84 2e-26 BLAST
Pfam:SPRY 87 199 1.2e-10 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000132441
AA Change: L30R
SMART Domains Protein: ENSMUSP00000115788
Gene: ENSMUSG00000044005
AA Change: L30R

DomainStartEndE-ValueType
Pfam:Glutaminase 1 37 7.9e-9 PFAM
ANK 92 122 3.76e-5 SMART
ANK 126 155 1.21e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134104
SMART Domains Protein: ENSMUSP00000123436
Gene: ENSMUSG00000044005

DomainStartEndE-ValueType
PDB:4JKT|D 60 172 1e-48 PDB
low complexity region 191 201 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135441
Predicted Effect probably benign
Transcript: ENSMUST00000143827
SMART Domains Protein: ENSMUSP00000119763
Gene: ENSMUSG00000044005

DomainStartEndE-ValueType
PDB:4JKT|D 67 135 5e-25 PDB
low complexity region 170 186 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145591
Predicted Effect probably benign
Transcript: ENSMUST00000159440
SMART Domains Protein: ENSMUSP00000124239
Gene: ENSMUSG00000044005

DomainStartEndE-ValueType
PDB:4JKT|D 67 134 9e-25 PDB
Meta Mutation Damage Score 0.148 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a mitochondrial phosphate-activated glutaminase that catalyzes the hydrolysis of glutamine to stoichiometric amounts of glutamate and ammonia. Originally thought to be liver-specific, this protein has been found in other tissues as well. Alternative splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 C A 8: 113,743,117 R651L probably damaging Het
Amd1 T C 10: 40,289,384 D317G possibly damaging Het
Artn A G 4: 117,927,618 probably benign Het
Asna1 A T 8: 85,025,264 M1K probably null Het
Bub1b T A 2: 118,641,123 V988E probably benign Het
Cyp2c65 G T 19: 39,073,218 C216F probably benign Het
Cyp3a11 T C 5: 145,868,607 E200G probably benign Het
Cyp3a25 T A 5: 145,986,842 K330N probably damaging Het
Duox2 C A 2: 122,284,583 V1138L probably benign Het
Erc2 A G 14: 28,011,694 D567G probably damaging Het
Eri2 A G 7: 119,793,916 probably null Het
Foxa3 A G 7: 19,023,369 Y17H probably damaging Het
Fto T C 8: 91,474,312 S324P probably damaging Het
Gstcd A T 3: 132,986,408 L582H probably damaging Het
Gtf3c1 G A 7: 125,647,614 R1508* probably null Het
Kif21a T C 15: 90,969,774 probably null Het
Klra5 A T 6: 129,906,614 D93E possibly damaging Het
Lgr5 T C 10: 115,454,499 D456G probably damaging Het
Mau2 A G 8: 70,030,655 S186P probably damaging Het
Msr1 T C 8: 39,589,382 D384G possibly damaging Het
Mum1 C A 10: 80,238,879 probably null Het
Ncf4 T C 15: 78,253,303 V93A probably damaging Het
Oas1f T G 5: 120,856,426 C337G probably damaging Het
Olfr119 A G 17: 37,701,041 M124V probably damaging Het
Olfr482 A T 7: 108,095,222 F116Y probably benign Het
Olfr820 T A 10: 130,018,003 L214H probably damaging Het
Rasl10b T C 11: 83,418,693 S159P probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Smg8 C A 11: 87,080,423 D841Y probably damaging Het
Sox7 T C 14: 63,943,949 V65A probably damaging Het
Sp140 C T 1: 85,620,051 probably benign Het
Srsf10 A G 4: 135,863,190 Y142C possibly damaging Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tcerg1l A G 7: 138,276,655 V326A probably benign Het
Tcl1b5 T A 12: 105,179,067 W97R probably damaging Het
Tmem108 T C 9: 103,499,657 R198G possibly damaging Het
Ube2ql1 T A 13: 69,738,898 Q148L possibly damaging Het
Vmn1r5 A T 6: 56,985,585 I82L probably benign Het
Wdr6 A T 9: 108,575,864 S273R probably damaging Het
Ylpm1 C T 12: 84,997,076 probably benign Het
Zfp90 G A 8: 106,425,506 R617Q possibly damaging Het
Other mutations in Gls2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Gls2 APN 10 128200971 unclassified probably null
IGL00583:Gls2 APN 10 128204882 missense probably benign 0.11
IGL01444:Gls2 APN 10 128201347 missense probably damaging 1.00
IGL02746:Gls2 APN 10 128200956 missense probably damaging 1.00
R0015:Gls2 UTSW 10 128209350 missense probably damaging 1.00
R0024:Gls2 UTSW 10 128199256 missense probably damaging 1.00
R1179:Gls2 UTSW 10 128199234 missense probably damaging 1.00
R1227:Gls2 UTSW 10 128199664 missense probably damaging 1.00
R1421:Gls2 UTSW 10 128201348 nonsense probably null
R1750:Gls2 UTSW 10 128201325 missense probably damaging 1.00
R1952:Gls2 UTSW 10 128209362 missense probably benign
R2218:Gls2 UTSW 10 128204714 missense probably damaging 1.00
R2291:Gls2 UTSW 10 128207610 nonsense probably null
R2382:Gls2 UTSW 10 128203842 missense probably damaging 1.00
R4536:Gls2 UTSW 10 128200937 missense probably benign 0.00
R5305:Gls2 UTSW 10 128204709 nonsense probably null
R5435:Gls2 UTSW 10 128195126 intron probably benign
R5767:Gls2 UTSW 10 128205221 missense probably damaging 1.00
R7223:Gls2 UTSW 10 128199194 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCCAAAGGGGCATCAACTTCTG -3'
(R):5'- AGGCCACTGCTGAAGTCTTGTG -3'

Sequencing Primer
(F):5'- tcaggaggcagaggcag -3'
(R):5'- GAAGTCTTGTGGAATGTATGATACC -3'
Posted On2013-05-09