Incidental Mutation 'R0409:Rnpepl1'
ID36496
Institutional Source Beutler Lab
Gene Symbol Rnpepl1
Ensembl Gene ENSMUSG00000026269
Gene Namearginyl aminopeptidase (aminopeptidase B)-like 1
Synonyms
MMRRC Submission 038611-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R0409 (G1)
Quality Score140
Status Validated
Chromosome1
Chromosomal Location92910783-92924384 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 92915860 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 234 (Y234C)
Ref Sequence ENSEMBL: ENSMUSP00000027487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027487] [ENSMUST00000178116]
Predicted Effect probably damaging
Transcript: ENSMUST00000027487
AA Change: Y234C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027487
Gene: ENSMUSG00000026269
AA Change: Y234C

DomainStartEndE-ValueType
low complexity region 10 27 N/A INTRINSIC
Pfam:Peptidase_M1 36 440 3e-58 PFAM
Leuk-A4-hydro_C 523 668 1.31e-46 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178116
SMART Domains Protein: ENSMUSP00000136080
Gene: ENSMUSG00000026269

DomainStartEndE-ValueType
Pfam:Peptidase_M1 5 170 1.2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178361
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178778
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178816
Predicted Effect probably benign
Transcript: ENSMUST00000179127
Predicted Effect probably benign
Transcript: ENSMUST00000179531
Predicted Effect probably benign
Transcript: ENSMUST00000179837
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179854
Predicted Effect unknown
Transcript: ENSMUST00000179993
AA Change: Y148C
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180306
Meta Mutation Damage Score 0.034 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.8%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A C 4: 42,972,203 K512T probably damaging Het
1700113H08Rik G T 10: 87,225,954 A89S probably damaging Het
4933417A18Rik A T 13: 34,924,549 I5L probably benign Het
Alkbh3 T A 2: 94,001,448 I146F possibly damaging Het
Aox2 A T 1: 58,336,624 I871F possibly damaging Het
Birc2 A C 9: 7,819,384 V509G possibly damaging Het
Car7 G A 8: 104,548,424 A165T probably damaging Het
Ccdc81 A G 7: 89,886,215 V271A probably benign Het
Cdc40 G T 10: 40,847,168 H302N probably damaging Het
Cep104 C T 4: 153,983,053 probably benign Het
Cfap54 C A 10: 92,776,213 S3161I probably benign Het
Chil5 A G 3: 106,034,966 probably benign Het
Chil6 C T 3: 106,404,176 G96D probably benign Het
Cnot1 T C 8: 95,748,855 K531E probably damaging Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Disp3 T G 4: 148,271,959 E148A probably damaging Het
Eps8l2 A G 7: 141,342,980 Y52C probably damaging Het
Exph5 C A 9: 53,374,343 T908K probably benign Het
Fat4 C T 3: 38,977,413 S2449F probably damaging Het
Faxc T A 4: 21,948,751 N154K probably benign Het
Fbxo43 C T 15: 36,162,357 A235T probably benign Het
Fnip1 A G 11: 54,480,354 probably null Het
Fsd1l T C 4: 53,679,932 L210P probably benign Het
Gm6420 A C 1: 23,256,038 S123R unknown Het
Gm8801 T G 17: 35,947,376 noncoding transcript Het
Gmfb T C 14: 46,816,222 I36V probably benign Het
Gsap G A 5: 21,222,445 probably benign Het
Hectd1 T A 12: 51,782,556 I969L possibly damaging Het
Il21r G T 7: 125,629,840 probably benign Het
Lrrc7 A G 3: 158,161,426 F893L possibly damaging Het
Map2 A G 1: 66,433,580 I1715V probably damaging Het
Mlh3 A G 12: 85,240,854 I1339T possibly damaging Het
Nacad T C 11: 6,599,810 D1127G probably benign Het
Noc3l A G 19: 38,817,927 probably benign Het
Nup93 A G 8: 94,303,665 D384G probably damaging Het
Olfr1036 T A 2: 86,075,302 C187* probably null Het
Olfr474 T C 7: 107,955,226 I195T probably benign Het
Olfr889 C T 9: 38,116,251 L152F probably benign Het
Pls1 A T 9: 95,786,919 probably benign Het
Prkcb A T 7: 122,424,977 H75L probably damaging Het
Rev1 A T 1: 38,074,368 Y539* probably null Het
Rnf10 A T 5: 115,255,447 probably benign Het
Sdk2 T C 11: 113,850,891 probably benign Het
Sec23b T A 2: 144,567,912 M240K probably benign Het
Sema5a A T 15: 32,681,609 N945Y probably damaging Het
Snapc4 C A 2: 26,367,216 R799L probably benign Het
Tctn3 T C 19: 40,611,416 probably benign Het
Tfpt G A 7: 3,620,899 Q50* probably null Het
Trim80 T C 11: 115,441,213 V77A probably damaging Het
Trp73 T A 4: 154,064,384 D256V possibly damaging Het
Utrn G T 10: 12,643,601 N2202K probably benign Het
Vps13c T A 9: 67,951,644 F2792Y probably benign Het
Other mutations in Rnpepl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Rnpepl1 APN 1 92915899 missense possibly damaging 0.69
IGL01291:Rnpepl1 APN 1 92919746 missense probably benign
IGL02266:Rnpepl1 APN 1 92916889 missense probably damaging 1.00
IGL02481:Rnpepl1 APN 1 92915907 missense probably damaging 1.00
IGL02483:Rnpepl1 APN 1 92915907 missense probably damaging 1.00
IGL03377:Rnpepl1 APN 1 92919231 missense probably benign 0.01
ANU05:Rnpepl1 UTSW 1 92919746 missense probably benign
R0069:Rnpepl1 UTSW 1 92918898 missense possibly damaging 0.91
R0479:Rnpepl1 UTSW 1 92918865 unclassified probably benign
R1155:Rnpepl1 UTSW 1 92916887 missense probably damaging 1.00
R1170:Rnpepl1 UTSW 1 92919195 missense possibly damaging 0.56
R1397:Rnpepl1 UTSW 1 92917159 missense probably damaging 1.00
R1601:Rnpepl1 UTSW 1 92917222 missense possibly damaging 0.95
R2184:Rnpepl1 UTSW 1 92916823 missense probably benign 0.43
R2187:Rnpepl1 UTSW 1 92916895 missense probably null 1.00
R2211:Rnpepl1 UTSW 1 92916380 missense probably damaging 1.00
R2902:Rnpepl1 UTSW 1 92916380 missense probably damaging 1.00
R3105:Rnpepl1 UTSW 1 92916380 missense probably damaging 1.00
R3196:Rnpepl1 UTSW 1 92917159 missense probably damaging 1.00
R3439:Rnpepl1 UTSW 1 92916940 missense possibly damaging 0.94
R4887:Rnpepl1 UTSW 1 92915113 missense probably damaging 1.00
R4966:Rnpepl1 UTSW 1 92916761 missense probably damaging 1.00
R5212:Rnpepl1 UTSW 1 92911323 missense probably benign 0.03
R5214:Rnpepl1 UTSW 1 92919279 missense probably benign 0.01
R5385:Rnpepl1 UTSW 1 92917192 missense probably damaging 1.00
R5655:Rnpepl1 UTSW 1 92919310 missense probably damaging 1.00
R5694:Rnpepl1 UTSW 1 92918941 missense probably benign 0.03
R5940:Rnpepl1 UTSW 1 92917712 missense probably damaging 1.00
R6046:Rnpepl1 UTSW 1 92916821 missense probably damaging 1.00
R6086:Rnpepl1 UTSW 1 92917681 missense probably damaging 1.00
R6104:Rnpepl1 UTSW 1 92915884 missense probably benign
R6349:Rnpepl1 UTSW 1 92919841 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATATGGATGGAGTTCGCTGACCTG -3'
(R):5'- CCTGGATGGTCTCCTTCACACAAC -3'

Sequencing Primer
(F):5'- GGACCATAAGGTCCCCTGTTAC -3'
(R):5'- CTTAAGGAACCCAAGGTGAATTCTG -3'
Posted On2013-05-09