Incidental Mutation 'R0409:Fsd1l'
ID36508
Institutional Source Beutler Lab
Gene Symbol Fsd1l
Ensembl Gene ENSMUSG00000054752
Gene Namefibronectin type III and SPRY domain containing 1-like
SynonymsA230072O16Rik, Csdufd1, Fsd1nl, Ccdc10
MMRRC Submission 038611-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.549) question?
Stock #R0409 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location53631471-53707009 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53679932 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 210 (L210P)
Ref Sequence ENSEMBL: ENSMUSP00000124613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000132151] [ENSMUST00000159415] [ENSMUST00000163067] [ENSMUST00000180164]
Predicted Effect probably benign
Transcript: ENSMUST00000132151
AA Change: L210P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000114931
Gene: ENSMUSG00000054752
AA Change: L210P

DomainStartEndE-ValueType
BBC 4 130 4.3e-8 SMART
FN3 165 255 2.21e-3 SMART
Pfam:SPRY 350 470 3.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159415
AA Change: L210P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000124002
Gene: ENSMUSG00000054752
AA Change: L210P

DomainStartEndE-ValueType
BBC 4 130 4.3e-8 SMART
FN3 165 255 2.21e-3 SMART
Pfam:SPRY 360 480 2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163067
AA Change: L210P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000124613
Gene: ENSMUSG00000054752
AA Change: L210P

DomainStartEndE-ValueType
BBC 4 130 4.3e-8 SMART
FN3 165 255 2.21e-3 SMART
Pfam:SPRY 349 469 3.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179534
AA Change: L210P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000136849
Gene: ENSMUSG00000054752
AA Change: L210P

DomainStartEndE-ValueType
BBC 4 130 4.3e-8 SMART
FN3 165 255 2.21e-3 SMART
Pfam:SPRY 362 479 2.6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180164
AA Change: L210P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000136184
Gene: ENSMUSG00000054752
AA Change: L210P

DomainStartEndE-ValueType
BBC 4 130 1.4e-7 SMART
FN3 165 255 2.21e-3 SMART
Pfam:SPRY 350 470 1.2e-16 PFAM
Meta Mutation Damage Score 0.114 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.8%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A C 4: 42,972,203 K512T probably damaging Het
1700113H08Rik G T 10: 87,225,954 A89S probably damaging Het
4933417A18Rik A T 13: 34,924,549 I5L probably benign Het
Alkbh3 T A 2: 94,001,448 I146F possibly damaging Het
Aox2 A T 1: 58,336,624 I871F possibly damaging Het
Birc2 A C 9: 7,819,384 V509G possibly damaging Het
Car7 G A 8: 104,548,424 A165T probably damaging Het
Ccdc81 A G 7: 89,886,215 V271A probably benign Het
Cdc40 G T 10: 40,847,168 H302N probably damaging Het
Cep104 C T 4: 153,983,053 probably benign Het
Cfap54 C A 10: 92,776,213 S3161I probably benign Het
Chil5 A G 3: 106,034,966 probably benign Het
Chil6 C T 3: 106,404,176 G96D probably benign Het
Cnot1 T C 8: 95,748,855 K531E probably damaging Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Disp3 T G 4: 148,271,959 E148A probably damaging Het
Eps8l2 A G 7: 141,342,980 Y52C probably damaging Het
Exph5 C A 9: 53,374,343 T908K probably benign Het
Fat4 C T 3: 38,977,413 S2449F probably damaging Het
Faxc T A 4: 21,948,751 N154K probably benign Het
Fbxo43 C T 15: 36,162,357 A235T probably benign Het
Fnip1 A G 11: 54,480,354 probably null Het
Gm6420 A C 1: 23,256,038 S123R unknown Het
Gm8801 T G 17: 35,947,376 noncoding transcript Het
Gmfb T C 14: 46,816,222 I36V probably benign Het
Gsap G A 5: 21,222,445 probably benign Het
Hectd1 T A 12: 51,782,556 I969L possibly damaging Het
Il21r G T 7: 125,629,840 probably benign Het
Lrrc7 A G 3: 158,161,426 F893L possibly damaging Het
Map2 A G 1: 66,433,580 I1715V probably damaging Het
Mlh3 A G 12: 85,240,854 I1339T possibly damaging Het
Nacad T C 11: 6,599,810 D1127G probably benign Het
Noc3l A G 19: 38,817,927 probably benign Het
Nup93 A G 8: 94,303,665 D384G probably damaging Het
Olfr1036 T A 2: 86,075,302 C187* probably null Het
Olfr474 T C 7: 107,955,226 I195T probably benign Het
Olfr889 C T 9: 38,116,251 L152F probably benign Het
Pls1 A T 9: 95,786,919 probably benign Het
Prkcb A T 7: 122,424,977 H75L probably damaging Het
Rev1 A T 1: 38,074,368 Y539* probably null Het
Rnf10 A T 5: 115,255,447 probably benign Het
Rnpepl1 A G 1: 92,915,860 Y234C probably damaging Het
Sdk2 T C 11: 113,850,891 probably benign Het
Sec23b T A 2: 144,567,912 M240K probably benign Het
Sema5a A T 15: 32,681,609 N945Y probably damaging Het
Snapc4 C A 2: 26,367,216 R799L probably benign Het
Tctn3 T C 19: 40,611,416 probably benign Het
Tfpt G A 7: 3,620,899 Q50* probably null Het
Trim80 T C 11: 115,441,213 V77A probably damaging Het
Trp73 T A 4: 154,064,384 D256V possibly damaging Het
Utrn G T 10: 12,643,601 N2202K probably benign Het
Vps13c T A 9: 67,951,644 F2792Y probably benign Het
Other mutations in Fsd1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Fsd1l APN 4 53682187 missense probably damaging 1.00
IGL01019:Fsd1l APN 4 53694742 missense probably damaging 1.00
IGL01154:Fsd1l APN 4 53701074 missense probably benign 0.01
IGL01359:Fsd1l APN 4 53659601 missense possibly damaging 0.78
IGL01996:Fsd1l APN 4 53647760 missense probably benign 0.00
IGL02192:Fsd1l APN 4 53647754 missense probably benign
IGL02629:Fsd1l APN 4 53686417 missense probably damaging 1.00
R0009:Fsd1l UTSW 4 53687209 missense probably benign 0.01
R0166:Fsd1l UTSW 4 53647664 splice site probably null
R0255:Fsd1l UTSW 4 53694727 missense probably damaging 1.00
R0349:Fsd1l UTSW 4 53679854 missense probably damaging 0.97
R1886:Fsd1l UTSW 4 53696984 splice site probably null
R1887:Fsd1l UTSW 4 53696984 splice site probably null
R2039:Fsd1l UTSW 4 53679972 missense probably benign 0.02
R2289:Fsd1l UTSW 4 53696931 missense possibly damaging 0.64
R4577:Fsd1l UTSW 4 53686397 missense probably damaging 1.00
R5134:Fsd1l UTSW 4 53647766 missense probably benign 0.43
R6073:Fsd1l UTSW 4 53679994 missense probably damaging 1.00
R6216:Fsd1l UTSW 4 53694742 missense probably damaging 1.00
R7184:Fsd1l UTSW 4 53694054 missense probably damaging 1.00
R7285:Fsd1l UTSW 4 53682200 critical splice donor site probably null
R7423:Fsd1l UTSW 4 53686406 missense probably damaging 1.00
R7465:Fsd1l UTSW 4 53647755 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCTTTGCAGTCCCAAAAGCTCCAG -3'
(R):5'- GCTCTGAAATATTGCTTCCACAGCATC -3'

Sequencing Primer
(F):5'- GCTCCAGAGATTGACCCAGTAG -3'
(R):5'- CACTTGCCTTACATACACTATGTTAG -3'
Posted On2013-05-09