Incidental Mutation 'R0409:Exph5'
ID 36523
Institutional Source Beutler Lab
Gene Symbol Exph5
Ensembl Gene ENSMUSG00000034584
Gene Name exophilin 5
Synonyms AC079869.22gm5, Slac2b, slac2-b, B130009M24Rik
MMRRC Submission 038611-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0409 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 53212970-53288814 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 53285643 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 908 (T908K)
Ref Sequence ENSEMBL: ENSMUSP00000062632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051014]
AlphaFold Q0VAV2
Predicted Effect probably benign
Transcript: ENSMUST00000051014
AA Change: T908K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000062632
Gene: ENSMUSG00000034584
AA Change: T908K

DomainStartEndE-ValueType
low complexity region 112 131 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
low complexity region 673 682 N/A INTRINSIC
low complexity region 970 980 N/A INTRINSIC
low complexity region 1556 1568 N/A INTRINSIC
low complexity region 1747 1757 N/A INTRINSIC
low complexity region 1937 1959 N/A INTRINSIC
Meta Mutation Damage Score 0.0884 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.8%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the synaptotagmin-like protein (Slp) family lacking a C2 domain. It contains an N-terminal synaptotagmin-like homology domain (SHD), and is a ras-related protein Rab-27B effector protein. This protein is thought to be involved in exosome secretion and intracellular vesicle trafficking. Reduced expression of this gene results in keratin filament defects. Mutations in this gene have been associated with some cases of epidermolysis bullosa, an inherited skin fragility disorder. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik G T 10: 87,061,816 (GRCm39) A89S probably damaging Het
Alkbh3 T A 2: 93,831,793 (GRCm39) I146F possibly damaging Het
Aox1 A T 1: 58,375,783 (GRCm39) I871F possibly damaging Het
Birc2 A C 9: 7,819,385 (GRCm39) V509G possibly damaging Het
Car7 G A 8: 105,275,056 (GRCm39) A165T probably damaging Het
Ccdc81 A G 7: 89,535,423 (GRCm39) V271A probably benign Het
Cdc40 G T 10: 40,723,164 (GRCm39) H302N probably damaging Het
Cep104 C T 4: 154,067,510 (GRCm39) probably benign Het
Cfap54 C A 10: 92,612,075 (GRCm39) S3161I probably benign Het
Chil5 A G 3: 105,942,282 (GRCm39) probably benign Het
Chil6 C T 3: 106,311,492 (GRCm39) G96D probably benign Het
Cnot1 T C 8: 96,475,483 (GRCm39) K531E probably damaging Het
Colgalt2 G T 1: 152,384,312 (GRCm39) A551S possibly damaging Het
Disp3 T G 4: 148,356,416 (GRCm39) E148A probably damaging Het
Eps8l2 A G 7: 140,922,893 (GRCm39) Y52C probably damaging Het
Fat4 C T 3: 39,031,562 (GRCm39) S2449F probably damaging Het
Faxc T A 4: 21,948,751 (GRCm39) N154K probably benign Het
Fbxo43 C T 15: 36,162,503 (GRCm39) A235T probably benign Het
Fnip1 A G 11: 54,371,180 (GRCm39) probably null Het
Fsd1l T C 4: 53,679,932 (GRCm39) L210P probably benign Het
Gm6420 A C 1: 23,295,119 (GRCm39) S123R unknown Het
Gm8801 T G 17: 36,258,268 (GRCm39) noncoding transcript Het
Gmfb T C 14: 47,053,679 (GRCm39) I36V probably benign Het
Gsap G A 5: 21,427,443 (GRCm39) probably benign Het
Hectd1 T A 12: 51,829,339 (GRCm39) I969L possibly damaging Het
Il21r G T 7: 125,229,012 (GRCm39) probably benign Het
Lrrc7 A G 3: 157,867,063 (GRCm39) F893L possibly damaging Het
Map2 A G 1: 66,472,739 (GRCm39) I1715V probably damaging Het
Mlh3 A G 12: 85,287,628 (GRCm39) I1339T possibly damaging Het
Nacad T C 11: 6,549,810 (GRCm39) D1127G probably benign Het
Noc3l A G 19: 38,806,371 (GRCm39) probably benign Het
Nup93 A G 8: 95,030,293 (GRCm39) D384G probably damaging Het
Or5m9b T A 2: 85,905,646 (GRCm39) C187* probably null Het
Or5p54 T C 7: 107,554,433 (GRCm39) I195T probably benign Het
Or8b40 C T 9: 38,027,547 (GRCm39) L152F probably benign Het
Pls1 A T 9: 95,668,972 (GRCm39) probably benign Het
Prkcb A T 7: 122,024,200 (GRCm39) H75L probably damaging Het
Rev1 A T 1: 38,113,449 (GRCm39) Y539* probably null Het
Rnf10 A T 5: 115,393,506 (GRCm39) probably benign Het
Rnpepl1 A G 1: 92,843,582 (GRCm39) Y234C probably damaging Het
Sdk2 T C 11: 113,741,717 (GRCm39) probably benign Het
Sec23b T A 2: 144,409,832 (GRCm39) M240K probably benign Het
Sema5a A T 15: 32,681,755 (GRCm39) N945Y probably damaging Het
Snapc4 C A 2: 26,257,228 (GRCm39) R799L probably benign Het
Spata31g1 A C 4: 42,972,203 (GRCm39) K512T probably damaging Het
Tctn3 T C 19: 40,599,860 (GRCm39) probably benign Het
Tex56 A T 13: 35,108,532 (GRCm39) I5L probably benign Het
Tfpt G A 7: 3,623,898 (GRCm39) Q50* probably null Het
Trim80 T C 11: 115,332,039 (GRCm39) V77A probably damaging Het
Trp73 T A 4: 154,148,841 (GRCm39) D256V possibly damaging Het
Utrn G T 10: 12,519,345 (GRCm39) N2202K probably benign Het
Vps13c T A 9: 67,858,926 (GRCm39) F2792Y probably benign Het
Other mutations in Exph5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Exph5 APN 9 53,288,006 (GRCm39) nonsense probably null
IGL01387:Exph5 APN 9 53,285,265 (GRCm39) missense possibly damaging 0.95
IGL01985:Exph5 APN 9 53,287,869 (GRCm39) missense probably damaging 0.99
IGL02122:Exph5 APN 9 53,284,974 (GRCm39) missense probably benign 0.05
IGL02156:Exph5 APN 9 53,286,941 (GRCm39) missense probably damaging 0.96
IGL02192:Exph5 APN 9 53,287,625 (GRCm39) nonsense probably null
IGL02491:Exph5 APN 9 53,286,343 (GRCm39) missense possibly damaging 0.89
PIT4802001:Exph5 UTSW 9 53,286,278 (GRCm39) missense probably damaging 0.96
R0002:Exph5 UTSW 9 53,285,256 (GRCm39) missense probably damaging 0.99
R0026:Exph5 UTSW 9 53,287,779 (GRCm39) missense probably benign 0.38
R0086:Exph5 UTSW 9 53,249,230 (GRCm39) missense possibly damaging 0.90
R0152:Exph5 UTSW 9 53,264,504 (GRCm39) critical splice donor site probably null
R0369:Exph5 UTSW 9 53,284,602 (GRCm39) missense probably benign 0.35
R0517:Exph5 UTSW 9 53,284,062 (GRCm39) missense probably benign 0.02
R0658:Exph5 UTSW 9 53,288,775 (GRCm39) missense unknown
R1606:Exph5 UTSW 9 53,285,595 (GRCm39) missense probably benign 0.37
R1739:Exph5 UTSW 9 53,286,888 (GRCm39) missense possibly damaging 0.62
R1769:Exph5 UTSW 9 53,285,109 (GRCm39) missense probably benign 0.35
R1828:Exph5 UTSW 9 53,287,941 (GRCm39) missense possibly damaging 0.79
R1862:Exph5 UTSW 9 53,287,548 (GRCm39) missense probably benign
R1993:Exph5 UTSW 9 53,284,935 (GRCm39) missense possibly damaging 0.79
R2012:Exph5 UTSW 9 53,278,466 (GRCm39) missense possibly damaging 0.49
R2044:Exph5 UTSW 9 53,283,979 (GRCm39) missense possibly damaging 0.79
R2402:Exph5 UTSW 9 53,286,225 (GRCm39) nonsense probably null
R3817:Exph5 UTSW 9 53,286,794 (GRCm39) nonsense probably null
R4771:Exph5 UTSW 9 53,284,965 (GRCm39) missense possibly damaging 0.95
R4869:Exph5 UTSW 9 53,287,539 (GRCm39) missense possibly damaging 0.73
R4926:Exph5 UTSW 9 53,287,925 (GRCm39) missense possibly damaging 0.95
R4996:Exph5 UTSW 9 53,286,910 (GRCm39) missense possibly damaging 0.79
R5254:Exph5 UTSW 9 53,249,230 (GRCm39) missense probably damaging 0.99
R5522:Exph5 UTSW 9 53,285,613 (GRCm39) missense possibly damaging 0.90
R5947:Exph5 UTSW 9 53,286,522 (GRCm39) missense probably benign 0.04
R5961:Exph5 UTSW 9 53,288,555 (GRCm39) missense probably damaging 1.00
R6093:Exph5 UTSW 9 53,283,917 (GRCm39) missense possibly damaging 0.94
R6144:Exph5 UTSW 9 53,284,328 (GRCm39) missense probably benign 0.21
R6254:Exph5 UTSW 9 53,284,010 (GRCm39) missense possibly damaging 0.81
R6279:Exph5 UTSW 9 53,285,246 (GRCm39) missense possibly damaging 0.78
R6300:Exph5 UTSW 9 53,285,246 (GRCm39) missense possibly damaging 0.78
R6485:Exph5 UTSW 9 53,287,991 (GRCm39) missense possibly damaging 0.89
R6553:Exph5 UTSW 9 53,213,012 (GRCm39) start gained probably benign
R6792:Exph5 UTSW 9 53,286,617 (GRCm39) missense possibly damaging 0.52
R7026:Exph5 UTSW 9 53,251,728 (GRCm39) missense probably benign 0.27
R7340:Exph5 UTSW 9 53,288,309 (GRCm39) missense probably damaging 0.99
R7347:Exph5 UTSW 9 53,287,196 (GRCm39) missense possibly damaging 0.79
R7352:Exph5 UTSW 9 53,287,022 (GRCm39) missense probably benign 0.00
R7520:Exph5 UTSW 9 53,278,514 (GRCm39) critical splice donor site probably null
R7521:Exph5 UTSW 9 53,285,377 (GRCm39) missense possibly damaging 0.89
R7560:Exph5 UTSW 9 53,287,073 (GRCm39) missense probably benign 0.41
R7581:Exph5 UTSW 9 53,283,857 (GRCm39) missense possibly damaging 0.90
R7726:Exph5 UTSW 9 53,284,475 (GRCm39) missense possibly damaging 0.62
R7976:Exph5 UTSW 9 53,287,935 (GRCm39) missense possibly damaging 0.79
R8017:Exph5 UTSW 9 53,284,752 (GRCm39) missense probably benign
R8019:Exph5 UTSW 9 53,284,752 (GRCm39) missense probably benign
R8302:Exph5 UTSW 9 53,287,776 (GRCm39) missense possibly damaging 0.89
R8420:Exph5 UTSW 9 53,287,148 (GRCm39) nonsense probably null
R8551:Exph5 UTSW 9 53,285,351 (GRCm39) missense possibly damaging 0.94
R8708:Exph5 UTSW 9 53,287,096 (GRCm39) missense probably benign
R8889:Exph5 UTSW 9 53,287,955 (GRCm39) missense probably damaging 1.00
R9048:Exph5 UTSW 9 53,284,935 (GRCm39) missense possibly damaging 0.79
R9255:Exph5 UTSW 9 53,284,609 (GRCm39) missense possibly damaging 0.79
R9727:Exph5 UTSW 9 53,287,702 (GRCm39) missense probably damaging 0.96
X0028:Exph5 UTSW 9 53,287,563 (GRCm39) missense probably damaging 1.00
Z1177:Exph5 UTSW 9 53,288,719 (GRCm39) missense probably benign
Z1177:Exph5 UTSW 9 53,285,513 (GRCm39) missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- TCCAAGAAAGTGGAACAGCGACATC -3'
(R):5'- ACAGCATCGTGTGGAAGTGCAG -3'

Sequencing Primer
(F):5'- GTGGAACAGCGACATCTCTTC -3'
(R):5'- GTGGAAGTGCAGGACTGTC -3'
Posted On 2013-05-09