Incidental Mutation 'R0410:Plcg2'
ID36591
Institutional Source Beutler Lab
Gene Symbol Plcg2
Ensembl Gene ENSMUSG00000034330
Gene Namephospholipase C, gamma 2
SynonymsPlcg-2, PLCgamma2
MMRRC Submission 038612-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0410 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location117498291-117635142 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 117615373 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1158 (I1158F)
Ref Sequence ENSEMBL: ENSMUSP00000079991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081232]
PDB Structure
Crystal structure of the N-terminal SH2 domain of mouse phospholipase C-gamma 2 [X-RAY DIFFRACTION]
Solution structure of the SH3 domain from Phospholipase C, gamma 2 [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000081232
AA Change: I1158F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000079991
Gene: ENSMUSG00000034330
AA Change: I1158F

DomainStartEndE-ValueType
PH 21 133 1.87e-4 SMART
PLCXc 312 456 2.29e-96 SMART
low complexity region 461 476 N/A INTRINSIC
PDB:2K2J|A 478 516 6e-17 PDB
SH2 530 623 2.24e-30 SMART
SH2 644 726 1.16e-28 SMART
SH3 772 828 3.12e-18 SMART
PH 789 910 4.31e0 SMART
PLCYc 930 1044 1.18e-66 SMART
C2 1062 1167 1.41e-15 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane signaling enzyme that catalyzes the conversion of 1-phosphatidyl-1D-myo-inositol 4,5-bisphosphate to 1D-myo-inositol 1,4,5-trisphosphate (IP3) and diacylglycerol (DAG) using calcium as a cofactor. IP3 and DAG are second messenger molecules important for transmitting signals from growth factor receptors and immune system receptors across the cell membrane. Mutations in this gene have been found in autoinflammation, antibody deficiency, and immune dysregulation syndrome and familial cold autoinflammatory syndrome 3. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for some null alleles show decreased B cell and impaired NK cell function. Other homozygous null alleles show aberrant separation of blood and lymphatic vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,469,732 D170G probably benign Het
Actrt3 C T 3: 30,598,124 G274S probably benign Het
Adamts18 G T 8: 113,714,358 C889* probably null Het
AF529169 T G 9: 89,602,203 E380D probably damaging Het
Alkbh6 C T 7: 30,312,606 P104S probably damaging Het
Alms1 A T 6: 85,587,803 E53V unknown Het
Ap3s1 T C 18: 46,779,212 C100R probably benign Het
Apbb2 G T 5: 66,451,806 A166E possibly damaging Het
Asph A G 4: 9,595,415 V174A probably damaging Het
Cacna2d2 T C 9: 107,524,620 L758P probably damaging Het
Cacng5 A G 11: 107,877,369 S271P possibly damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Chn1 A T 2: 73,631,750 C236* probably null Het
Coro1b T C 19: 4,149,363 V7A probably damaging Het
Dhx16 A G 17: 35,890,967 Y962C probably damaging Het
Dixdc1 T C 9: 50,684,853 D152G probably damaging Het
Dmrt1 T C 19: 25,506,103 S84P probably damaging Het
Dnah10 A G 5: 124,755,735 D844G probably benign Het
Edn3 C T 2: 174,761,689 P77S possibly damaging Het
Efcab7 T C 4: 99,878,285 probably null Het
Fam83g A G 11: 61,703,392 D584G probably damaging Het
Fbxo7 T A 10: 86,029,238 probably null Het
Ffar1 T C 7: 30,860,630 T281A probably benign Het
Fntb T C 12: 76,888,052 V201A probably benign Het
Gart C A 16: 91,641,327 A101S probably damaging Het
Gbp9 T C 5: 105,085,073 T238A probably benign Het
Hectd4 T C 5: 121,286,266 L663S possibly damaging Het
Helz2 A T 2: 181,230,593 V2512E probably damaging Het
Hip1 A C 5: 135,458,155 L66R probably damaging Het
Iigp1 T A 18: 60,390,303 D164E probably benign Het
Kcnip3 A G 2: 127,460,066 S193P probably damaging Het
Klra9 T A 6: 130,188,744 T103S probably benign Het
Meis2 T C 2: 115,864,228 *471W probably null Het
Mrpl21 T C 19: 3,284,792 S45P possibly damaging Het
Mterf1b A G 5: 4,196,488 E43G probably benign Het
Mycbp2 G T 14: 103,135,133 S4092R probably damaging Het
Nfatc3 A T 8: 106,096,196 N538I probably damaging Het
Nphp4 T C 4: 152,557,046 C1095R probably benign Het
Npm2 T A 14: 70,652,553 T13S probably benign Het
Olfr24 C A 9: 18,754,841 V265F probably damaging Het
Olfr872 T A 9: 20,260,501 F220L probably benign Het
Popdc3 T C 10: 45,317,733 V210A possibly damaging Het
Postn T C 3: 54,385,277 L755S possibly damaging Het
Prdx6b T C 2: 80,293,029 F61L probably damaging Het
Rars C T 11: 35,826,020 R223H probably damaging Het
Robo1 G A 16: 72,971,984 G479D possibly damaging Het
Scaf4 A G 16: 90,260,170 Y98H unknown Het
Scn4a A G 11: 106,323,949 I1274T probably damaging Het
Senp2 G T 16: 22,009,694 R18L probably damaging Het
Six5 T A 7: 19,096,456 V336D probably damaging Het
Slc31a2 G A 4: 62,292,653 E8K probably benign Het
Slc4a7 A T 14: 14,738,299 T184S probably damaging Het
Slco2a1 T A 9: 103,073,314 probably null Het
Smr3a T G 5: 88,008,211 probably benign Het
Sqor T C 2: 122,787,522 V100A probably benign Het
Srarp T C 4: 141,433,148 N125D possibly damaging Het
Stam T C 2: 14,138,991 V364A probably benign Het
Tgm5 T C 2: 121,077,558 I46V possibly damaging Het
Tie1 A T 4: 118,480,569 V443E probably damaging Het
Tipin T C 9: 64,288,115 M1T probably null Het
Tnc T C 4: 64,007,694 T950A probably benign Het
Tns3 T C 11: 8,435,852 D1382G probably benign Het
Tor1aip1 A G 1: 156,035,940 V99A possibly damaging Het
Trim16 C T 11: 62,820,471 probably benign Het
Ttn G T 2: 76,788,357 N14448K possibly damaging Het
Ttn C T 2: 76,886,860 probably benign Het
Vmn1r23 A G 6: 57,926,190 I201T probably benign Het
Vmn2r13 T A 5: 109,173,813 K339N probably benign Het
Yap1 A G 9: 8,001,467 Y173H probably damaging Het
Zcchc11 A G 4: 108,486,555 R255G probably benign Het
Other mutations in Plcg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Plcg2 APN 8 117556071 missense possibly damaging 0.89
IGL00911:Plcg2 APN 8 117586515 missense probably benign 0.17
IGL00952:Plcg2 APN 8 117607217 missense probably benign
IGL01115:Plcg2 APN 8 117557329 missense probably damaging 1.00
IGL01326:Plcg2 APN 8 117573999 splice site probably benign
IGL01357:Plcg2 APN 8 117614161 splice site probably benign
IGL01705:Plcg2 APN 8 117581662 missense probably damaging 1.00
IGL01755:Plcg2 APN 8 117621241 missense possibly damaging 0.48
IGL01828:Plcg2 APN 8 117590233 missense probably damaging 1.00
IGL02307:Plcg2 APN 8 117579896 critical splice donor site probably null
IGL02345:Plcg2 APN 8 117585180 missense probably damaging 0.99
IGL02448:Plcg2 APN 8 117607221 missense probably benign
IGL02587:Plcg2 APN 8 117558113 missense possibly damaging 0.80
IGL02646:Plcg2 APN 8 117603883 missense possibly damaging 0.88
IGL03409:Plcg2 APN 8 117583495 missense probably damaging 0.96
Poseidon UTSW 8 117615238 missense probably damaging 1.00
Poseidon2 UTSW 8 117577874 missense possibly damaging 0.80
queen UTSW 8 117581707 missense probably benign 0.00
Theseus UTSW 8 117596332 missense probably damaging 0.99
trident UTSW 8 117612978 missense probably benign 0.00
R0172:Plcg2 UTSW 8 117579782 missense probably benign 0.00
R0194:Plcg2 UTSW 8 117573397 splice site probably benign
R0462:Plcg2 UTSW 8 117585305 missense probably benign 0.06
R0494:Plcg2 UTSW 8 117556104 missense probably damaging 1.00
R0522:Plcg2 UTSW 8 117614288 splice site probably null
R0612:Plcg2 UTSW 8 117573365 missense probably benign 0.01
R1239:Plcg2 UTSW 8 117556044 missense probably benign
R1367:Plcg2 UTSW 8 117615238 missense probably damaging 1.00
R1608:Plcg2 UTSW 8 117614235 missense possibly damaging 0.89
R1756:Plcg2 UTSW 8 117592708 missense probably benign 0.02
R2176:Plcg2 UTSW 8 117612994 missense probably damaging 1.00
R3500:Plcg2 UTSW 8 117612978 missense probably benign 0.00
R4043:Plcg2 UTSW 8 117612978 missense probably benign 0.00
R4654:Plcg2 UTSW 8 117504315 missense probably benign
R4883:Plcg2 UTSW 8 117607133 nonsense probably null
R4932:Plcg2 UTSW 8 117607083 missense probably benign 0.05
R5080:Plcg2 UTSW 8 117590003 missense probably benign 0.10
R5226:Plcg2 UTSW 8 117577874 missense possibly damaging 0.80
R5264:Plcg2 UTSW 8 117634793 missense possibly damaging 0.95
R5298:Plcg2 UTSW 8 117605249 missense probably benign
R5473:Plcg2 UTSW 8 117634401 missense probably benign
R5555:Plcg2 UTSW 8 117612995 nonsense probably null
R5557:Plcg2 UTSW 8 117586557 missense probably damaging 0.99
R5805:Plcg2 UTSW 8 117598495 critical splice donor site probably null
R5826:Plcg2 UTSW 8 117610844 missense probably benign 0.19
R5871:Plcg2 UTSW 8 117504217 missense probably damaging 1.00
R5894:Plcg2 UTSW 8 117504349 missense probably damaging 0.99
R6142:Plcg2 UTSW 8 117585271 missense probably benign
R6609:Plcg2 UTSW 8 117568170 missense probably benign 0.31
R6684:Plcg2 UTSW 8 117596332 missense probably damaging 0.99
R6710:Plcg2 UTSW 8 117557347 missense probably benign 0.05
R6931:Plcg2 UTSW 8 117557319 missense probably benign 0.24
R6946:Plcg2 UTSW 8 117504190 missense probably benign
X0027:Plcg2 UTSW 8 117555983 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCACAAGTTGCAGTAAGCACAAGC -3'
(R):5'- GCCCGAGGCATCTCAAAATGAAAGC -3'

Sequencing Primer
(F):5'- CAGTAAGCACAAGCTTTGGTCTC -3'
(R):5'- GTTTCCTCAAAGAGGCCAAAGTTG -3'
Posted On2013-05-09