Incidental Mutation 'R4766:Enpp3'
ID366162
Institutional Source Beutler Lab
Gene Symbol Enpp3
Ensembl Gene ENSMUSG00000019989
Gene Nameectonucleotide pyrophosphatase/phosphodiesterase 3
SynonymsCD203c
MMRRC Submission 042407-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.252) question?
Stock #R4766 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location24772406-24842823 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24773927 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 867 (L867P)
Ref Sequence ENSEMBL: ENSMUSP00000020169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020169]
Predicted Effect probably damaging
Transcript: ENSMUST00000020169
AA Change: L867P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020169
Gene: ENSMUSG00000019989
AA Change: L867P

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
SO 50 93 1.99e-13 SMART
SO 94 137 7.66e-15 SMART
Pfam:Phosphodiest 161 485 1.7e-87 PFAM
Blast:Endonuclease_NS 543 599 9e-15 BLAST
Endonuclease_NS 626 847 5.41e-16 SMART
NUC 627 856 1.54e-92 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219861
Meta Mutation Damage Score 0.104 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 97% (87/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a series of ectoenzymes that are involved in hydrolysis of extracellular nucleotides. These ectoenzymes possess ATPase and ATP pyrophosphatase activities and are type II transmembrane proteins. Expression of the related rat mRNA has been found in a subset of immature glial cells and in the alimentary tract. The corresponding rat protein has been detected in the pancreas, small intestine, colon, and liver. The human mRNA is expressed in glioma cells, prostate, and uterus. Expression of the human protein has been detected in uterus, basophils, and mast cells. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knockout allele exhibit increased numbers of basophils and mast cells with increased susceptibility to chronic allergic responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik C T 5: 113,097,636 V1584I probably benign Het
A430105I19Rik C A 2: 118,759,577 R262L probably damaging Het
Adamts12 A G 15: 11,285,901 D732G probably benign Het
Agpat4 A G 17: 12,151,750 probably benign Het
AI182371 T C 2: 35,095,817 D140G possibly damaging Het
Apol11b T A 15: 77,634,933 T316S probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bard1 T C 1: 71,075,174 E216G probably benign Het
Bdp1 C A 13: 100,049,868 R1692L probably damaging Het
Capn10 T C 1: 92,943,419 I101T probably damaging Het
Ccdc175 C T 12: 72,112,205 M653I probably benign Het
Ccr8 G A 9: 120,094,464 C215Y probably damaging Het
Cct3 T A 3: 88,311,785 L241* probably null Het
Cd2ap A T 17: 42,852,459 I25N probably damaging Het
Cdh19 T C 1: 110,893,260 K583E probably benign Het
Cela3a A G 4: 137,402,675 S212P unknown Het
Cfap44 T A 16: 44,415,883 probably null Het
Clca3a1 A T 3: 144,749,712 L440Q probably damaging Het
Crybg2 A G 4: 134,089,352 Y1676C probably damaging Het
Dscam T C 16: 96,643,988 D1501G probably benign Het
Eml6 C A 11: 29,805,757 L832F probably benign Het
Erbb3 A G 10: 128,586,238 Y46H possibly damaging Het
Fads3 T C 19: 10,056,020 I342T possibly damaging Het
Flvcr1 A T 1: 191,021,106 S290T probably benign Het
Fut9 A G 4: 25,799,191 probably benign Het
Gad2 C T 2: 22,622,667 A2V probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm10715 T G 9: 3,038,073 probably benign Het
Herc1 T G 9: 66,441,929 D2023E probably benign Het
Hsd3b3 A G 3: 98,742,485 L174P probably damaging Het
Impg2 TACCACCACCACCACCACCACCACCA TACCACCACCACCACCACCACCA 16: 56,257,939 probably benign Het
Iqcf3 A G 9: 106,560,949 probably null Het
Kcna4 G A 2: 107,296,543 V541M probably damaging Het
Kcnj11 T C 7: 46,099,816 T28A probably benign Het
Kcnmb2 T A 3: 32,181,867 N88K probably damaging Het
Kdm2a TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC TTCCTCCTCCTCCTCTTCCTCCTCCTC 19: 4,324,507 probably benign Het
Krt2 T C 15: 101,813,960 E430G probably damaging Het
Lins1 C T 7: 66,710,641 L384F possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mfge8 T C 7: 79,134,525 N389D probably damaging Het
Mug1 C T 6: 121,884,254 T1278I probably benign Het
Myh9 T C 15: 77,807,877 M161V probably damaging Het
Myl7 T A 11: 5,898,171 Y61F probably benign Het
Nlrp4d A T 7: 10,362,779 unknown Het
Nol3 A G 8: 105,281,933 probably null Het
Nup85 T A 11: 115,577,925 probably null Het
Obscn T A 11: 59,012,742 T7619S probably damaging Het
Olfr1298 T C 2: 111,645,881 M39V probably benign Het
Olfr331 T A 11: 58,501,668 N296I probably damaging Het
Olfr628 C T 7: 103,732,250 T108I possibly damaging Het
Olfr844 G A 9: 19,318,845 V104I probably benign Het
Pax5 T A 4: 44,679,494 I184F probably damaging Het
Pcdha7 T A 18: 36,974,507 V195D probably damaging Het
Phf3 A T 1: 30,813,939 probably benign Het
Pla2g15 G T 8: 106,163,071 G325V probably damaging Het
Ppp1r21 T C 17: 88,572,615 F487L probably benign Het
Ppp1r9a A G 6: 5,157,016 I965V probably benign Het
Ptpru A G 4: 131,820,964 V74A probably damaging Het
Rif1 T A 2: 52,098,934 Y780N probably damaging Het
Rps25 T A 9: 44,408,749 Y23N possibly damaging Het
Ryr1 T C 7: 29,085,833 D1811G probably damaging Het
Scamp5 T G 9: 57,452,036 probably null Het
Senp1 T C 15: 98,045,896 D602G probably damaging Het
Sh2b2 T G 5: 136,231,957 D135A probably damaging Het
Slc26a8 G A 17: 28,638,661 T836M probably benign Het
Slfn4 T G 11: 83,186,821 I145S possibly damaging Het
Spag6l G A 16: 16,777,390 T377I probably benign Het
Spdye4b T C 5: 143,196,334 F129S probably damaging Het
Sspo G A 6: 48,470,580 G2360E probably benign Het
Taar2 A T 10: 23,940,771 I70F probably damaging Het
Taar7e A G 10: 24,038,566 N318S probably damaging Het
Tor1a C A 2: 30,967,730 R42L probably benign Het
Trdn A T 10: 33,474,506 Q690H probably benign Het
Trim56 C A 5: 137,112,725 V646L probably benign Het
Tspan15 T A 10: 62,191,544 K165I probably benign Het
Usp24 A G 4: 106,416,048 Y2210C probably damaging Het
Usp45 A G 4: 21,797,307 T76A probably damaging Het
Vps13c T A 9: 67,878,224 probably null Het
Zfp512b T C 2: 181,585,095 probably benign Het
Zyx C A 6: 42,356,159 probably null Het
Other mutations in Enpp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Enpp3 APN 10 24787772 missense probably benign 0.00
IGL00778:Enpp3 APN 10 24798262 missense probably damaging 1.00
IGL01147:Enpp3 APN 10 24774907 missense probably damaging 1.00
IGL01343:Enpp3 APN 10 24805922 nonsense probably null
IGL01642:Enpp3 APN 10 24798269 missense probably damaging 1.00
IGL01814:Enpp3 APN 10 24792025 missense possibly damaging 0.68
IGL02083:Enpp3 APN 10 24776794 missense probably damaging 1.00
IGL02152:Enpp3 APN 10 24774002 missense probably damaging 1.00
IGL02186:Enpp3 APN 10 24791983 splice site probably benign
IGL02517:Enpp3 APN 10 24809848 splice site probably benign
IGL02956:Enpp3 APN 10 24774943 splice site probably benign
R0017:Enpp3 UTSW 10 24799153 splice site probably null
R0042:Enpp3 UTSW 10 24774824 missense probably damaging 1.00
R0110:Enpp3 UTSW 10 24776781 missense probably damaging 1.00
R0218:Enpp3 UTSW 10 24776869 missense possibly damaging 0.80
R0403:Enpp3 UTSW 10 24804436 missense probably damaging 1.00
R0433:Enpp3 UTSW 10 24820597 missense probably benign 0.00
R0450:Enpp3 UTSW 10 24776781 missense probably damaging 1.00
R0510:Enpp3 UTSW 10 24776781 missense probably damaging 1.00
R0826:Enpp3 UTSW 10 24795716 missense probably damaging 1.00
R1245:Enpp3 UTSW 10 24784953 splice site probably benign
R1261:Enpp3 UTSW 10 24774934 missense probably damaging 0.97
R1633:Enpp3 UTSW 10 24795782 missense probably damaging 1.00
R1903:Enpp3 UTSW 10 24778789 missense probably damaging 1.00
R1913:Enpp3 UTSW 10 24776771 nonsense probably null
R1966:Enpp3 UTSW 10 24807491 missense probably damaging 0.99
R2157:Enpp3 UTSW 10 24776878 missense probably damaging 1.00
R2179:Enpp3 UTSW 10 24805895 missense probably benign 0.00
R2380:Enpp3 UTSW 10 24776872 missense probably benign
R2410:Enpp3 UTSW 10 24774818 missense probably benign 0.00
R3794:Enpp3 UTSW 10 24831732 splice site probably null
R3896:Enpp3 UTSW 10 24777949 missense possibly damaging 0.79
R4334:Enpp3 UTSW 10 24793589 missense probably damaging 1.00
R4569:Enpp3 UTSW 10 24776882 missense probably damaging 1.00
R4951:Enpp3 UTSW 10 24798277 missense probably damaging 1.00
R4998:Enpp3 UTSW 10 24807538 missense probably benign 0.01
R5045:Enpp3 UTSW 10 24776767 missense probably damaging 1.00
R5276:Enpp3 UTSW 10 24809916 missense probably damaging 1.00
R5331:Enpp3 UTSW 10 24808160 missense probably damaging 1.00
R5569:Enpp3 UTSW 10 24778821 missense probably damaging 0.98
R5975:Enpp3 UTSW 10 24774842 missense probably benign 0.37
R6117:Enpp3 UTSW 10 24787852 missense probably damaging 1.00
R6419:Enpp3 UTSW 10 24808191 missense probably damaging 1.00
R6677:Enpp3 UTSW 10 24777957 missense possibly damaging 0.88
R6735:Enpp3 UTSW 10 24807453 missense probably damaging 1.00
R6833:Enpp3 UTSW 10 24809870 missense probably damaging 1.00
R6999:Enpp3 UTSW 10 24808166 missense probably damaging 1.00
R7022:Enpp3 UTSW 10 24826195 missense probably damaging 0.99
R7173:Enpp3 UTSW 10 24774047 missense probably damaging 1.00
R7224:Enpp3 UTSW 10 24776884 missense possibly damaging 0.63
R7227:Enpp3 UTSW 10 24817844 missense unknown
X0026:Enpp3 UTSW 10 24826242 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATGCGTTTCTGCCAAATAC -3'
(R):5'- ACGGGGAAAATGGTTTTGCG -3'

Sequencing Primer
(F):5'- AATGTCACCAGCTCTATAGGACTCTG -3'
(R):5'- GCGTTTCATTTCTCAGGAAAACAAG -3'
Posted On2015-12-21