Incidental Mutation 'R4766:Bdp1'
ID366174
Institutional Source Beutler Lab
Gene Symbol Bdp1
Ensembl Gene ENSMUSG00000049658
Gene NameB double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB
SynonymsTAF3B1, TFC5, Tfnr, B130055N23Rik, TFIIIB90, TFIIIB150, G630013P12Rik
MMRRC Submission 042407-MU
Accession Numbers

Genbank: NM_001081061; MGI: 1347077

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4766 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location100017994-100104070 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 100049868 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 1692 (R1692L)
Ref Sequence ENSEMBL: ENSMUSP00000105005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038104] [ENSMUST00000109379]
Predicted Effect probably damaging
Transcript: ENSMUST00000038104
AA Change: R1692L

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000038321
Gene: ENSMUSG00000049658
AA Change: R1692L

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
low complexity region 81 92 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
SANT 301 349 1.52e-4 SMART
coiled coil region 375 399 N/A INTRINSIC
coiled coil region 457 487 N/A INTRINSIC
internal_repeat_1 593 895 3.56e-18 PROSPERO
coiled coil region 1013 1038 N/A INTRINSIC
internal_repeat_1 1253 1612 3.56e-18 PROSPERO
low complexity region 1718 1733 N/A INTRINSIC
low complexity region 1763 1774 N/A INTRINSIC
low complexity region 1912 1921 N/A INTRINSIC
low complexity region 2185 2199 N/A INTRINSIC
low complexity region 2335 2346 N/A INTRINSIC
low complexity region 2398 2412 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000099262
AA Change: R321L
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105697
Predicted Effect probably damaging
Transcript: ENSMUST00000109379
AA Change: R1692L

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105005
Gene: ENSMUSG00000049658
AA Change: R1692L

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
low complexity region 81 92 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
SANT 301 349 1.52e-4 SMART
coiled coil region 457 487 N/A INTRINSIC
internal_repeat_1 593 895 4.79e-19 PROSPERO
coiled coil region 1013 1038 N/A INTRINSIC
internal_repeat_1 1253 1612 4.79e-19 PROSPERO
low complexity region 1718 1733 N/A INTRINSIC
low complexity region 1763 1774 N/A INTRINSIC
low complexity region 1912 1921 N/A INTRINSIC
low complexity region 2185 2199 N/A INTRINSIC
low complexity region 2335 2346 N/A INTRINSIC
low complexity region 2398 2412 N/A INTRINSIC
Meta Mutation Damage Score 0.228 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 97% (87/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a subunit of the TFIIIB transcription initiation complex, which recruits RNA polymerase III to target promoters in order to initiate transcription. The encoded protein localizes to concentrated aggregates in the nucleus, and is required for transcription from all three types of polymerase III promoters. It is phosphorylated by casein kinase II during mitosis, resulting in its release from chromatin and suppression of polymerase III transcription. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik C T 5: 113,097,636 V1584I probably benign Het
A430105I19Rik C A 2: 118,759,577 R262L probably damaging Het
Adamts12 A G 15: 11,285,901 D732G probably benign Het
Agpat4 A G 17: 12,151,750 probably benign Het
AI182371 T C 2: 35,095,817 D140G possibly damaging Het
Apol11b T A 15: 77,634,933 T316S probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bard1 T C 1: 71,075,174 E216G probably benign Het
Capn10 T C 1: 92,943,419 I101T probably damaging Het
Ccdc175 C T 12: 72,112,205 M653I probably benign Het
Ccr8 G A 9: 120,094,464 C215Y probably damaging Het
Cct3 T A 3: 88,311,785 L241* probably null Het
Cd2ap A T 17: 42,852,459 I25N probably damaging Het
Cdh19 T C 1: 110,893,260 K583E probably benign Het
Cela3a A G 4: 137,402,675 S212P unknown Het
Cfap44 T A 16: 44,415,883 probably null Het
Clca3a1 A T 3: 144,749,712 L440Q probably damaging Het
Crybg2 A G 4: 134,089,352 Y1676C probably damaging Het
Dscam T C 16: 96,643,988 D1501G probably benign Het
Eml6 C A 11: 29,805,757 L832F probably benign Het
Enpp3 A G 10: 24,773,927 L867P probably damaging Het
Erbb3 A G 10: 128,586,238 Y46H possibly damaging Het
Fads3 T C 19: 10,056,020 I342T possibly damaging Het
Flvcr1 A T 1: 191,021,106 S290T probably benign Het
Fut9 A G 4: 25,799,191 probably benign Het
Gad2 C T 2: 22,622,667 A2V probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm10715 T G 9: 3,038,073 probably benign Het
Herc1 T G 9: 66,441,929 D2023E probably benign Het
Hsd3b3 A G 3: 98,742,485 L174P probably damaging Het
Impg2 TACCACCACCACCACCACCACCACCA TACCACCACCACCACCACCACCA 16: 56,257,939 probably benign Het
Iqcf3 A G 9: 106,560,949 probably null Het
Kcna4 G A 2: 107,296,543 V541M probably damaging Het
Kcnj11 T C 7: 46,099,816 T28A probably benign Het
Kcnmb2 T A 3: 32,181,867 N88K probably damaging Het
Kdm2a TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC TTCCTCCTCCTCCTCTTCCTCCTCCTC 19: 4,324,507 probably benign Het
Krt2 T C 15: 101,813,960 E430G probably damaging Het
Lins1 C T 7: 66,710,641 L384F possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mfge8 T C 7: 79,134,525 N389D probably damaging Het
Mug1 C T 6: 121,884,254 T1278I probably benign Het
Myh9 T C 15: 77,807,877 M161V probably damaging Het
Myl7 T A 11: 5,898,171 Y61F probably benign Het
Nlrp4d A T 7: 10,362,779 unknown Het
Nol3 A G 8: 105,281,933 probably null Het
Nup85 T A 11: 115,577,925 probably null Het
Obscn T A 11: 59,012,742 T7619S probably damaging Het
Olfr1298 T C 2: 111,645,881 M39V probably benign Het
Olfr331 T A 11: 58,501,668 N296I probably damaging Het
Olfr628 C T 7: 103,732,250 T108I possibly damaging Het
Olfr844 G A 9: 19,318,845 V104I probably benign Het
Pax5 T A 4: 44,679,494 I184F probably damaging Het
Pcdha7 T A 18: 36,974,507 V195D probably damaging Het
Phf3 A T 1: 30,813,939 probably benign Het
Pla2g15 G T 8: 106,163,071 G325V probably damaging Het
Ppp1r21 T C 17: 88,572,615 F487L probably benign Het
Ppp1r9a A G 6: 5,157,016 I965V probably benign Het
Ptpru A G 4: 131,820,964 V74A probably damaging Het
Rif1 T A 2: 52,098,934 Y780N probably damaging Het
Rps25 T A 9: 44,408,749 Y23N possibly damaging Het
Ryr1 T C 7: 29,085,833 D1811G probably damaging Het
Scamp5 T G 9: 57,452,036 probably null Het
Senp1 T C 15: 98,045,896 D602G probably damaging Het
Sh2b2 T G 5: 136,231,957 D135A probably damaging Het
Slc26a8 G A 17: 28,638,661 T836M probably benign Het
Slfn4 T G 11: 83,186,821 I145S possibly damaging Het
Spag6l G A 16: 16,777,390 T377I probably benign Het
Spdye4b T C 5: 143,196,334 F129S probably damaging Het
Sspo G A 6: 48,470,580 G2360E probably benign Het
Taar2 A T 10: 23,940,771 I70F probably damaging Het
Taar7e A G 10: 24,038,566 N318S probably damaging Het
Tor1a C A 2: 30,967,730 R42L probably benign Het
Trdn A T 10: 33,474,506 Q690H probably benign Het
Trim56 C A 5: 137,112,725 V646L probably benign Het
Tspan15 T A 10: 62,191,544 K165I probably benign Het
Usp24 A G 4: 106,416,048 Y2210C probably damaging Het
Usp45 A G 4: 21,797,307 T76A probably damaging Het
Vps13c T A 9: 67,878,224 probably null Het
Zfp512b T C 2: 181,585,095 probably benign Het
Zyx C A 6: 42,356,159 probably null Het
Other mutations in Bdp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Bdp1 APN 13 100098510 missense probably damaging 1.00
IGL00096:Bdp1 APN 13 100060865 missense possibly damaging 0.61
IGL00160:Bdp1 APN 13 100061198 missense probably benign 0.00
IGL00924:Bdp1 APN 13 100097579 missense possibly damaging 0.89
IGL01337:Bdp1 APN 13 100056192 missense probably benign 0.00
IGL01344:Bdp1 APN 13 100078080 missense probably benign 0.06
IGL01347:Bdp1 APN 13 100070203 missense possibly damaging 0.79
IGL01620:Bdp1 APN 13 100084205 splice site probably benign
IGL01871:Bdp1 APN 13 100066053 missense probably benign 0.01
IGL02008:Bdp1 APN 13 100023827 missense possibly damaging 0.92
IGL02112:Bdp1 APN 13 100037800 missense probably benign 0.02
IGL02214:Bdp1 APN 13 100041535 missense probably benign 0.00
IGL02236:Bdp1 APN 13 100060891 missense probably benign
IGL02307:Bdp1 APN 13 100093438 missense probably damaging 1.00
IGL02364:Bdp1 APN 13 100055308 splice site probably benign
IGL02415:Bdp1 APN 13 100089408 missense probably damaging 0.96
IGL02601:Bdp1 APN 13 100098514 missense possibly damaging 0.72
IGL02605:Bdp1 APN 13 100078115 critical splice acceptor site probably null
IGL02664:Bdp1 APN 13 100051539 missense probably benign 0.29
IGL02738:Bdp1 APN 13 100051353 missense probably benign 0.26
IGL02754:Bdp1 APN 13 100060973 missense possibly damaging 0.94
IGL02967:Bdp1 APN 13 100042270 missense possibly damaging 0.92
IGL02974:Bdp1 APN 13 100055292 missense probably benign 0.00
IGL03156:Bdp1 APN 13 100061036 missense probably benign 0.44
IGL03166:Bdp1 APN 13 100035800 missense probably benign 0.28
IGL03232:Bdp1 APN 13 100051481 missense probably damaging 1.00
D3080:Bdp1 UTSW 13 100023621 missense probably benign 0.02
R0115:Bdp1 UTSW 13 100041454 missense probably benign 0.28
R0481:Bdp1 UTSW 13 100041454 missense probably benign 0.28
R0619:Bdp1 UTSW 13 100037858 missense probably benign 0.00
R0730:Bdp1 UTSW 13 100058951 splice site probably benign
R0744:Bdp1 UTSW 13 100035825 missense probably benign 0.01
R0833:Bdp1 UTSW 13 100035825 missense probably benign 0.01
R1307:Bdp1 UTSW 13 100049763 missense possibly damaging 0.89
R1325:Bdp1 UTSW 13 100099008 missense probably damaging 0.97
R1346:Bdp1 UTSW 13 100078755 nonsense probably null
R1644:Bdp1 UTSW 13 100060940 missense probably benign 0.03
R1670:Bdp1 UTSW 13 100027433 critical splice donor site probably null
R1836:Bdp1 UTSW 13 100035145 missense probably benign
R1869:Bdp1 UTSW 13 100042201 missense probably damaging 0.99
R1920:Bdp1 UTSW 13 100098589 missense probably benign 0.30
R1944:Bdp1 UTSW 13 100074381 splice site probably null
R2030:Bdp1 UTSW 13 100061189 missense probably benign 0.00
R2069:Bdp1 UTSW 13 100050988 missense probably benign 0.00
R2180:Bdp1 UTSW 13 100061405 small insertion probably benign
R2263:Bdp1 UTSW 13 100066037 missense probably damaging 0.96
R2277:Bdp1 UTSW 13 100061330 missense probably benign 0.05
R2277:Bdp1 UTSW 13 100061339 missense probably damaging 1.00
R2278:Bdp1 UTSW 13 100061330 missense probably benign 0.05
R2278:Bdp1 UTSW 13 100061339 missense probably damaging 1.00
R2336:Bdp1 UTSW 13 100053002 missense probably damaging 0.99
R2380:Bdp1 UTSW 13 100060370 missense probably benign 0.08
R3154:Bdp1 UTSW 13 100049814 missense probably damaging 1.00
R4212:Bdp1 UTSW 13 100059585 missense probably benign
R4322:Bdp1 UTSW 13 100092223 missense probably damaging 0.97
R4414:Bdp1 UTSW 13 100030861 missense probably damaging 0.99
R4415:Bdp1 UTSW 13 100030861 missense probably damaging 0.99
R4764:Bdp1 UTSW 13 100056267 missense probably damaging 0.99
R4888:Bdp1 UTSW 13 100051119 missense probably benign 0.26
R4914:Bdp1 UTSW 13 100056336 missense probably benign 0.28
R4917:Bdp1 UTSW 13 100055205 missense probably damaging 0.99
R4918:Bdp1 UTSW 13 100055205 missense probably damaging 0.99
R5170:Bdp1 UTSW 13 100030794 nonsense probably null
R5266:Bdp1 UTSW 13 100067535 missense probably benign 0.33
R5312:Bdp1 UTSW 13 100097601 splice site probably null
R5420:Bdp1 UTSW 13 100066043 missense possibly damaging 0.88
R5486:Bdp1 UTSW 13 100098510 missense probably damaging 1.00
R5909:Bdp1 UTSW 13 100092286 missense probably benign 0.08
R5913:Bdp1 UTSW 13 100051104 missense probably benign 0.41
R6018:Bdp1 UTSW 13 100038224 missense probably benign 0.00
R6037:Bdp1 UTSW 13 100027449 missense possibly damaging 0.65
R6037:Bdp1 UTSW 13 100027449 missense possibly damaging 0.65
R6700:Bdp1 UTSW 13 100025528 missense probably benign 0.00
R6969:Bdp1 UTSW 13 100074531 missense probably damaging 0.97
R6972:Bdp1 UTSW 13 100037761 missense probably null 1.00
R6996:Bdp1 UTSW 13 100043813 missense probably damaging 1.00
R7043:Bdp1 UTSW 13 100078707 missense probably benign 0.03
R7060:Bdp1 UTSW 13 100059494 missense probably damaging 1.00
R7105:Bdp1 UTSW 13 100070181 missense probably damaging 1.00
R7155:Bdp1 UTSW 13 100061151 missense possibly damaging 0.93
R7175:Bdp1 UTSW 13 100049970 missense probably damaging 0.97
R7177:Bdp1 UTSW 13 100049970 missense probably damaging 0.97
R7327:Bdp1 UTSW 13 100041532 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AACAGGTACAAACACTGGTGC -3'
(R):5'- AAGGCTTTCACTGAGATCATCC -3'

Sequencing Primer
(F):5'- AGGTACAAACACTGGTGCTTTGC -3'
(R):5'- ACTGAGATCATCCTGGTGCTTACATG -3'
Posted On2015-12-21