Incidental Mutation 'R4767:Pax6'
ID366199
Institutional Source Beutler Lab
Gene Symbol Pax6
Ensembl Gene ENSMUSG00000027168
Gene Namepaired box 6
SynonymsGsfaey11, Dey, Dickie's small eye, AEY11, Pax-6, 1500038E17Rik
MMRRC Submission 042408-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4767 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location105668900-105697364 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105695360 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 377 (S377P)
Ref Sequence ENSEMBL: ENSMUSP00000129344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090391] [ENSMUST00000090397] [ENSMUST00000111082] [ENSMUST00000111083] [ENSMUST00000111085] [ENSMUST00000111086] [ENSMUST00000111087] [ENSMUST00000111088] [ENSMUST00000167211]
Predicted Effect probably benign
Transcript: ENSMUST00000090391
AA Change: S377P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000087870
Gene: ENSMUSG00000027168
AA Change: S377P

DomainStartEndE-ValueType
PAX 4 142 7.36e-86 SMART
low complexity region 188 199 N/A INTRINSIC
HOX 224 286 4.93e-26 SMART
low complexity region 295 308 N/A INTRINSIC
low complexity region 401 409 N/A INTRINSIC
low complexity region 412 426 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090397
AA Change: S363P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000087878
Gene: ENSMUSG00000027168
AA Change: S363P

DomainStartEndE-ValueType
PAX 4 128 6.11e-92 SMART
low complexity region 174 185 N/A INTRINSIC
HOX 210 272 4.93e-26 SMART
low complexity region 281 294 N/A INTRINSIC
low complexity region 387 395 N/A INTRINSIC
low complexity region 398 412 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111082
AA Change: S363P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106711
Gene: ENSMUSG00000027168
AA Change: S363P

DomainStartEndE-ValueType
PAX 4 128 6.11e-92 SMART
low complexity region 174 185 N/A INTRINSIC
HOX 210 272 4.93e-26 SMART
low complexity region 281 294 N/A INTRINSIC
low complexity region 387 395 N/A INTRINSIC
low complexity region 398 412 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111083
AA Change: S363P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106712
Gene: ENSMUSG00000027168
AA Change: S363P

DomainStartEndE-ValueType
PAX 4 128 6.11e-92 SMART
low complexity region 174 185 N/A INTRINSIC
HOX 210 272 4.93e-26 SMART
low complexity region 281 294 N/A INTRINSIC
low complexity region 387 395 N/A INTRINSIC
low complexity region 398 412 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111085
AA Change: S377P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000106714
Gene: ENSMUSG00000027168
AA Change: S377P

DomainStartEndE-ValueType
PAX 4 142 7.36e-86 SMART
low complexity region 188 199 N/A INTRINSIC
HOX 224 286 4.93e-26 SMART
low complexity region 295 308 N/A INTRINSIC
low complexity region 401 409 N/A INTRINSIC
low complexity region 412 426 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111086
AA Change: S377P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000106715
Gene: ENSMUSG00000027168
AA Change: S377P

DomainStartEndE-ValueType
PAX 4 142 7.36e-86 SMART
low complexity region 188 199 N/A INTRINSIC
HOX 224 286 4.93e-26 SMART
low complexity region 295 308 N/A INTRINSIC
low complexity region 401 409 N/A INTRINSIC
low complexity region 412 426 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111087
AA Change: S363P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106716
Gene: ENSMUSG00000027168
AA Change: S363P

DomainStartEndE-ValueType
PAX 4 128 6.11e-92 SMART
low complexity region 174 185 N/A INTRINSIC
HOX 210 272 4.93e-26 SMART
low complexity region 281 294 N/A INTRINSIC
low complexity region 387 395 N/A INTRINSIC
low complexity region 398 412 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111088
SMART Domains Protein: ENSMUSP00000106717
Gene: ENSMUSG00000027168

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
HOX 39 101 4.93e-26 SMART
low complexity region 110 123 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123063
SMART Domains Protein: ENSMUSP00000121345
Gene: ENSMUSG00000027168

DomainStartEndE-ValueType
HOX 9 71 2.5e-28 SMART
low complexity region 80 93 N/A INTRINSIC
Blast:PAX 121 169 6e-24 BLAST
low complexity region 186 194 N/A INTRINSIC
low complexity region 197 211 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135412
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138365
SMART Domains Protein: ENSMUSP00000117154
Gene: ENSMUSG00000027168

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
PAX 33 192 4.87e-77 SMART
low complexity region 238 249 N/A INTRINSIC
SCOP:d1b72a_ 254 291 2e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140173
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145744
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146803
SMART Domains Protein: ENSMUSP00000133346
Gene: ENSMUSG00000027168

DomainStartEndE-ValueType
Blast:PAX 1 62 1e-26 BLAST
HOX 74 136 4.93e-26 SMART
low complexity region 145 158 N/A INTRINSIC
Blast:PAX 186 234 3e-23 BLAST
low complexity region 251 259 N/A INTRINSIC
low complexity region 262 276 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147946
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153011
SMART Domains Protein: ENSMUSP00000118457
Gene: ENSMUSG00000027168

DomainStartEndE-ValueType
PAX 2 109 4.98e-42 SMART
low complexity region 155 166 N/A INTRINSIC
Pfam:Homeobox 192 218 7.7e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154643
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155081
Predicted Effect probably benign
Transcript: ENSMUST00000167211
AA Change: S377P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000129344
Gene: ENSMUSG00000027168
AA Change: S377P

DomainStartEndE-ValueType
PAX 4 142 7.36e-86 SMART
low complexity region 188 199 N/A INTRINSIC
HOX 224 286 4.93e-26 SMART
low complexity region 295 308 N/A INTRINSIC
low complexity region 401 409 N/A INTRINSIC
low complexity region 412 426 N/A INTRINSIC
Meta Mutation Damage Score 0.06 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: This gene encodes a homeobox-containing protein that functions as a regulator of transcription. It plays a key role in the development of neural tissues, particularly the eye. Activity of this protein is also required for expression of glucagon in the pancreas. This gene is regulated by multiple enhancers located up to tens or hundreds of kilobases upstream and downstream of the transcription start sites. Mutations in this gene or deletion of these regulatory elements results in severe defects in eye development. Alternative splicing and the use of alternative promoters results in multiple transcript variants, some of which encode proteins that lack the N-terminal paired domain. [provided by RefSeq, Jul 2015]
PHENOTYPE: Null and hypomorphic mutants show a range of phenotypes from viable with small eyes and lens/cornea fusion to microphthalmia and cataract to embryonic or perinatal lethality with anophthalmia and severe craniofacial and forebrain defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 T C 11: 46,138,977 probably null Het
Aig1 T C 10: 13,801,858 N130S probably damaging Het
Alx1 A T 10: 103,025,186 Y160* probably null Het
Ap4e1 T C 2: 127,060,438 I755T probably benign Het
Apoc3 C A 9: 46,234,535 E21* probably null Het
Atp9b G T 18: 80,753,070 H919Q probably damaging Het
Cemip T G 7: 83,973,306 Y555S probably damaging Het
Cic T C 7: 25,271,600 V252A possibly damaging Het
Cracr2a A T 6: 127,611,507 N210Y probably damaging Het
Crocc2 G A 1: 93,202,856 R953Q possibly damaging Het
Csnk1d A G 11: 120,969,128 S318P probably benign Het
Ddx21 A G 10: 62,591,972 L384P probably damaging Het
Dnah5 C T 15: 28,270,474 T974I probably benign Het
Duox1 A G 2: 122,333,441 Y863C possibly damaging Het
Epg5 C A 18: 78,023,283 P2133T possibly damaging Het
Ephb6 A T 6: 41,614,185 Q92L possibly damaging Het
Ercc4 C A 16: 13,122,095 A73D probably damaging Het
Eva1c A T 16: 90,904,347 Y290F probably damaging Het
Galnt5 T A 2: 58,028,144 V798E possibly damaging Het
Haus4 T C 14: 54,548,885 E149G probably damaging Het
Ighv1-13 A G 12: 114,630,936 Y86C unknown Het
Igkv9-120 G T 6: 68,050,367 R88S possibly damaging Het
Lama3 T C 18: 12,500,563 V1584A probably benign Het
Lamb1 A G 12: 31,308,011 E1119G probably damaging Het
Lao1 T C 4: 118,967,988 L335P probably damaging Het
Mindy4 A G 6: 55,260,565 D375G probably damaging Het
Myo5a T C 9: 75,144,076 I317T probably damaging Het
Nhlrc2 G A 19: 56,570,466 V128I probably benign Het
Nlrp2 C T 7: 5,328,024 D458N probably damaging Het
Olfr107 T A 17: 37,406,200 C217* probably null Het
Olfr1497 A T 19: 13,795,045 C189S probably damaging Het
Olfr347 A T 2: 36,734,323 M1L probably benign Het
Olfr76 G T 19: 12,119,936 H247N probably damaging Het
Olfr938 T C 9: 39,078,692 T18A possibly damaging Het
Parp8 T C 13: 116,868,536 H663R probably damaging Het
Pi15 A G 1: 17,602,766 D63G probably benign Het
Plaa A G 4: 94,586,258 probably benign Het
Rbm5 C A 9: 107,745,213 W546C probably damaging Het
Rnf123 C A 9: 108,052,089 C1257F probably damaging Het
Rnf185 A G 11: 3,432,551 S45P possibly damaging Het
Sh3bp1 T C 15: 78,904,497 S241P possibly damaging Het
Slfn8 G A 11: 83,003,197 A872V possibly damaging Het
Smoc1 G A 12: 81,104,773 probably null Het
Sox14 A T 9: 99,875,633 W18R probably damaging Het
Spata31d1a T C 13: 59,701,155 E1053G probably benign Het
Syne1 T A 10: 5,344,866 K1246* probably null Het
Tbrg4 A C 11: 6,620,909 S188A probably benign Het
Thnsl2 A T 6: 71,134,295 D196E probably damaging Het
Tmem266 C T 9: 55,380,741 T34I probably damaging Het
Tmem59l C A 8: 70,486,098 R111L probably benign Het
Tpr T C 1: 150,430,529 probably benign Het
Trpc6 T C 9: 8,643,686 S491P probably damaging Het
Tspan10 A T 11: 120,446,166 N254I probably damaging Het
Ubox5 A T 2: 130,591,894 L511Q probably damaging Het
Vmn1r183 TATCCATC TATC 7: 24,055,106 probably null Het
Vmn2r4 C T 3: 64,390,976 C577Y probably damaging Het
Vmn2r86 A T 10: 130,455,737 M53K probably benign Het
Zfp948 T A 17: 21,588,307 I587N possibly damaging Het
Other mutations in Pax6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02008:Pax6 APN 2 105692278 critical splice donor site probably null
IGL02256:Pax6 APN 2 105684770 missense probably benign 0.16
IGL02500:Pax6 APN 2 105692770 missense probably benign 0.13
red_hots UTSW 2 105695360 missense probably benign 0.00
R1067:Pax6 UTSW 2 105680301 missense probably benign 0.01
R1213:Pax6 UTSW 2 105685913 missense probably benign 0.13
R1494:Pax6 UTSW 2 105691610 missense probably benign 0.16
R1633:Pax6 UTSW 2 105691718 missense probably damaging 1.00
R2291:Pax6 UTSW 2 105685883 missense probably benign 0.09
R3834:Pax6 UTSW 2 105696450 missense probably benign 0.00
R3835:Pax6 UTSW 2 105696450 missense probably benign 0.00
R4665:Pax6 UTSW 2 105683998 intron probably benign
R4714:Pax6 UTSW 2 105695400 missense possibly damaging 0.74
R4747:Pax6 UTSW 2 105696502 missense probably benign
R4764:Pax6 UTSW 2 105696502 missense probably benign
R4771:Pax6 UTSW 2 105696502 missense probably benign
R4772:Pax6 UTSW 2 105696502 missense probably benign
R4816:Pax6 UTSW 2 105683784 intron probably benign
R4819:Pax6 UTSW 2 105692277 critical splice donor site probably null
R5418:Pax6 UTSW 2 105691565 missense probably benign 0.00
R5683:Pax6 UTSW 2 105685907 missense probably benign 0.06
R6041:Pax6 UTSW 2 105683902 missense probably damaging 1.00
R6263:Pax6 UTSW 2 105692854 critical splice donor site probably null
R6651:Pax6 UTSW 2 105685830 missense probably benign 0.00
R6822:Pax6 UTSW 2 105685923 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGGTGGCCAATGAATTCTAGGAC -3'
(R):5'- TGAATGCAAGGTCAGAAGTTTC -3'

Sequencing Primer
(F):5'- GTGGCCAATGAATTCTAGGACATTCC -3'
(R):5'- TCTTCAAGACAATAGGAAACACAGTG -3'
Posted On2015-12-21