Incidental Mutation 'R4767:Thnsl2'
ID366210
Institutional Source Beutler Lab
Gene Symbol Thnsl2
Ensembl Gene ENSMUSG00000054474
Gene Namethreonine synthase-like 2 (bacterial)
SynonymsTSH2
MMRRC Submission 042408-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R4767 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location71128166-71144439 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 71134295 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 196 (D196E)
Ref Sequence ENSEMBL: ENSMUSP00000124423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074241] [ENSMUST00000160918]
Predicted Effect probably damaging
Transcript: ENSMUST00000074241
AA Change: D196E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073861
Gene: ENSMUSG00000054474
AA Change: D196E

DomainStartEndE-ValueType
Pfam:Thr_synth_N 2 81 2.4e-27 PFAM
Pfam:PALP 93 415 9.6e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000160918
AA Change: D196E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124423
Gene: ENSMUSG00000054474
AA Change: D196E

DomainStartEndE-ValueType
Pfam:Thr_synth_N 2 81 1.1e-27 PFAM
Pfam:PALP 94 413 8.4e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170455
Predicted Effect probably benign
Transcript: ENSMUST00000170753
SMART Domains Protein: ENSMUSP00000129994
Gene: ENSMUSG00000054474

DomainStartEndE-ValueType
PDB:4F4F|B 2 122 1e-11 PDB
SCOP:d1kl7a_ 2 129 1e-10 SMART
Meta Mutation Damage Score 0.0324 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a threonine synthase-like protein. A similar enzyme in mouse can catalyze the degradation of O-phospho-homoserine to a-ketobutyrate, phosphate, and ammonia. This protein also has phospho-lyase activity on both gamma and beta phosphorylated substrates. In mouse an alternatively spliced form of this protein has been shown to act as a cytokine and can induce the production of the inflammatory cytokine IL6 in osteoblasts. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 T C 11: 46,138,977 probably null Het
Aig1 T C 10: 13,801,858 N130S probably damaging Het
Alx1 A T 10: 103,025,186 Y160* probably null Het
Ap4e1 T C 2: 127,060,438 I755T probably benign Het
Apoc3 C A 9: 46,234,535 E21* probably null Het
Atp9b G T 18: 80,753,070 H919Q probably damaging Het
Cemip T G 7: 83,973,306 Y555S probably damaging Het
Cic T C 7: 25,271,600 V252A possibly damaging Het
Cracr2a A T 6: 127,611,507 N210Y probably damaging Het
Crocc2 G A 1: 93,202,856 R953Q possibly damaging Het
Csnk1d A G 11: 120,969,128 S318P probably benign Het
Ddx21 A G 10: 62,591,972 L384P probably damaging Het
Dnah5 C T 15: 28,270,474 T974I probably benign Het
Duox1 A G 2: 122,333,441 Y863C possibly damaging Het
Epg5 C A 18: 78,023,283 P2133T possibly damaging Het
Ephb6 A T 6: 41,614,185 Q92L possibly damaging Het
Ercc4 C A 16: 13,122,095 A73D probably damaging Het
Eva1c A T 16: 90,904,347 Y290F probably damaging Het
Galnt5 T A 2: 58,028,144 V798E possibly damaging Het
Haus4 T C 14: 54,548,885 E149G probably damaging Het
Ighv1-13 A G 12: 114,630,936 Y86C unknown Het
Igkv9-120 G T 6: 68,050,367 R88S possibly damaging Het
Lama3 T C 18: 12,500,563 V1584A probably benign Het
Lamb1 A G 12: 31,308,011 E1119G probably damaging Het
Lao1 T C 4: 118,967,988 L335P probably damaging Het
Mindy4 A G 6: 55,260,565 D375G probably damaging Het
Myo5a T C 9: 75,144,076 I317T probably damaging Het
Nhlrc2 G A 19: 56,570,466 V128I probably benign Het
Nlrp2 C T 7: 5,328,024 D458N probably damaging Het
Olfr107 T A 17: 37,406,200 C217* probably null Het
Olfr1497 A T 19: 13,795,045 C189S probably damaging Het
Olfr347 A T 2: 36,734,323 M1L probably benign Het
Olfr76 G T 19: 12,119,936 H247N probably damaging Het
Olfr938 T C 9: 39,078,692 T18A possibly damaging Het
Parp8 T C 13: 116,868,536 H663R probably damaging Het
Pax6 T C 2: 105,695,360 S377P probably benign Het
Pi15 A G 1: 17,602,766 D63G probably benign Het
Plaa A G 4: 94,586,258 probably benign Het
Rbm5 C A 9: 107,745,213 W546C probably damaging Het
Rnf123 C A 9: 108,052,089 C1257F probably damaging Het
Rnf185 A G 11: 3,432,551 S45P possibly damaging Het
Sh3bp1 T C 15: 78,904,497 S241P possibly damaging Het
Slfn8 G A 11: 83,003,197 A872V possibly damaging Het
Smoc1 G A 12: 81,104,773 probably null Het
Sox14 A T 9: 99,875,633 W18R probably damaging Het
Spata31d1a T C 13: 59,701,155 E1053G probably benign Het
Syne1 T A 10: 5,344,866 K1246* probably null Het
Tbrg4 A C 11: 6,620,909 S188A probably benign Het
Tmem266 C T 9: 55,380,741 T34I probably damaging Het
Tmem59l C A 8: 70,486,098 R111L probably benign Het
Tpr T C 1: 150,430,529 probably benign Het
Trpc6 T C 9: 8,643,686 S491P probably damaging Het
Tspan10 A T 11: 120,446,166 N254I probably damaging Het
Ubox5 A T 2: 130,591,894 L511Q probably damaging Het
Vmn1r183 TATCCATC TATC 7: 24,055,106 probably null Het
Vmn2r4 C T 3: 64,390,976 C577Y probably damaging Het
Vmn2r86 A T 10: 130,455,737 M53K probably benign Het
Zfp948 T A 17: 21,588,307 I587N possibly damaging Het
Other mutations in Thnsl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Thnsl2 APN 6 71131900 missense probably damaging 1.00
IGL00814:Thnsl2 APN 6 71139883 missense probably damaging 1.00
IGL01139:Thnsl2 APN 6 71138734 missense probably damaging 1.00
IGL01380:Thnsl2 APN 6 71138756 missense probably benign
IGL01511:Thnsl2 APN 6 71139793 missense probably benign 0.04
IGL02000:Thnsl2 APN 6 71134219 missense probably damaging 1.00
IGL03157:Thnsl2 APN 6 71131946 missense probably benign 0.00
R0372:Thnsl2 UTSW 6 71139790 missense probably damaging 1.00
R0380:Thnsl2 UTSW 6 71141330 missense probably damaging 1.00
R0521:Thnsl2 UTSW 6 71134259 missense probably damaging 1.00
R0815:Thnsl2 UTSW 6 71134224 nonsense probably null
R0863:Thnsl2 UTSW 6 71134224 nonsense probably null
R1300:Thnsl2 UTSW 6 71134191 missense probably damaging 1.00
R2867:Thnsl2 UTSW 6 71131961 missense probably damaging 1.00
R2867:Thnsl2 UTSW 6 71131961 missense probably damaging 1.00
R5578:Thnsl2 UTSW 6 71138765 missense probably benign 0.40
R5818:Thnsl2 UTSW 6 71134143 missense probably benign 0.01
R6627:Thnsl2 UTSW 6 71134215 missense possibly damaging 0.70
R6800:Thnsl2 UTSW 6 71141280 missense probably benign 0.29
X0021:Thnsl2 UTSW 6 71128704 missense probably benign 0.02
X0066:Thnsl2 UTSW 6 71139837 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGGTCTCCTTACCTGCAAG -3'
(R):5'- TTACACGGAGCCTGGAAAG -3'

Sequencing Primer
(F):5'- TGCAAGGTTACCCCCAGCTC -3'
(R):5'- CAGGCTAAATAAAACACGTCAAAGTG -3'
Posted On2015-12-21