Incidental Mutation 'R4767:Cemip'
ID366216
Institutional Source Beutler Lab
Gene Symbol Cemip
Ensembl Gene ENSMUSG00000052353
Gene Namecell migration inducing protein, hyaluronan binding
Synonyms6330404C01Rik, 9930013L23Rik, 12H19.01.T7
MMRRC Submission 042408-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.393) question?
Stock #R4767 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location83932857-84086502 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 83973306 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Serine at position 555 (Y555S)
Ref Sequence ENSEMBL: ENSMUSP00000063277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064174]
Predicted Effect probably damaging
Transcript: ENSMUST00000064174
AA Change: Y555S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063277
Gene: ENSMUSG00000052353
AA Change: Y555S

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
G8 44 166 9.01e-42 SMART
Pfam:ILEI 187 281 2.1e-28 PFAM
Pfam:Mucin2_WxxW 324 403 1.2e-13 PFAM
PbH1 572 594 7.34e3 SMART
PbH1 595 617 3.73e3 SMART
PbH1 719 741 4.11e3 SMART
PbH1 798 819 6.96e2 SMART
Blast:PbH1 844 882 7e-17 BLAST
Blast:PbH1 917 952 2e-15 BLAST
Pfam:ILEI 1244 1334 2.7e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147578
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150495
Meta Mutation Damage Score 0.396 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 95% (62/65)
MGI Phenotype PHENOTYPE: Mice homozygous for a conditional allele activated in Schwann cells exhibit transient acceleration of postnatal myelination, reduced demyelination in culture, and reduced myelin degradation and increases remyelination following nerve axotomy or sciatic nerve crush. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 T C 11: 46,138,977 probably null Het
Aig1 T C 10: 13,801,858 N130S probably damaging Het
Alx1 A T 10: 103,025,186 Y160* probably null Het
Ap4e1 T C 2: 127,060,438 I755T probably benign Het
Apoc3 C A 9: 46,234,535 E21* probably null Het
Atp9b G T 18: 80,753,070 H919Q probably damaging Het
Cic T C 7: 25,271,600 V252A possibly damaging Het
Cracr2a A T 6: 127,611,507 N210Y probably damaging Het
Crocc2 G A 1: 93,202,856 R953Q possibly damaging Het
Csnk1d A G 11: 120,969,128 S318P probably benign Het
Ddx21 A G 10: 62,591,972 L384P probably damaging Het
Dnah5 C T 15: 28,270,474 T974I probably benign Het
Duox1 A G 2: 122,333,441 Y863C possibly damaging Het
Epg5 C A 18: 78,023,283 P2133T possibly damaging Het
Ephb6 A T 6: 41,614,185 Q92L possibly damaging Het
Ercc4 C A 16: 13,122,095 A73D probably damaging Het
Eva1c A T 16: 90,904,347 Y290F probably damaging Het
Galnt5 T A 2: 58,028,144 V798E possibly damaging Het
Haus4 T C 14: 54,548,885 E149G probably damaging Het
Ighv1-13 A G 12: 114,630,936 Y86C unknown Het
Igkv9-120 G T 6: 68,050,367 R88S possibly damaging Het
Lama3 T C 18: 12,500,563 V1584A probably benign Het
Lamb1 A G 12: 31,308,011 E1119G probably damaging Het
Lao1 T C 4: 118,967,988 L335P probably damaging Het
Mindy4 A G 6: 55,260,565 D375G probably damaging Het
Myo5a T C 9: 75,144,076 I317T probably damaging Het
Nhlrc2 G A 19: 56,570,466 V128I probably benign Het
Nlrp2 C T 7: 5,328,024 D458N probably damaging Het
Olfr107 T A 17: 37,406,200 C217* probably null Het
Olfr1497 A T 19: 13,795,045 C189S probably damaging Het
Olfr347 A T 2: 36,734,323 M1L probably benign Het
Olfr76 G T 19: 12,119,936 H247N probably damaging Het
Olfr938 T C 9: 39,078,692 T18A possibly damaging Het
Parp8 T C 13: 116,868,536 H663R probably damaging Het
Pax6 T C 2: 105,695,360 S377P probably benign Het
Pi15 A G 1: 17,602,766 D63G probably benign Het
Plaa A G 4: 94,586,258 probably benign Het
Rbm5 C A 9: 107,745,213 W546C probably damaging Het
Rnf123 C A 9: 108,052,089 C1257F probably damaging Het
Rnf185 A G 11: 3,432,551 S45P possibly damaging Het
Sh3bp1 T C 15: 78,904,497 S241P possibly damaging Het
Slfn8 G A 11: 83,003,197 A872V possibly damaging Het
Smoc1 G A 12: 81,104,773 probably null Het
Sox14 A T 9: 99,875,633 W18R probably damaging Het
Spata31d1a T C 13: 59,701,155 E1053G probably benign Het
Syne1 T A 10: 5,344,866 K1246* probably null Het
Tbrg4 A C 11: 6,620,909 S188A probably benign Het
Thnsl2 A T 6: 71,134,295 D196E probably damaging Het
Tmem266 C T 9: 55,380,741 T34I probably damaging Het
Tmem59l C A 8: 70,486,098 R111L probably benign Het
Tpr T C 1: 150,430,529 probably benign Het
Trpc6 T C 9: 8,643,686 S491P probably damaging Het
Tspan10 A T 11: 120,446,166 N254I probably damaging Het
Ubox5 A T 2: 130,591,894 L511Q probably damaging Het
Vmn1r183 TATCCATC TATC 7: 24,055,106 probably null Het
Vmn2r4 C T 3: 64,390,976 C577Y probably damaging Het
Vmn2r86 A T 10: 130,455,737 M53K probably benign Het
Zfp948 T A 17: 21,588,307 I587N possibly damaging Het
Other mutations in Cemip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Cemip APN 7 83947280 missense possibly damaging 0.63
IGL01520:Cemip APN 7 83948622 missense probably benign 0.27
IGL01646:Cemip APN 7 83983232 missense possibly damaging 0.81
IGL02057:Cemip APN 7 83987453 missense probably damaging 1.00
IGL02058:Cemip APN 7 83997292 missense probably damaging 0.99
IGL02120:Cemip APN 7 83951563 missense probably damaging 0.99
IGL02278:Cemip APN 7 83937438 missense probably damaging 1.00
IGL02331:Cemip APN 7 83963984 critical splice donor site probably null
IGL02366:Cemip APN 7 83943641 missense probably benign 0.08
IGL02434:Cemip APN 7 83955284 missense probably damaging 0.98
IGL02622:Cemip APN 7 83964175 missense probably damaging 1.00
IGL02958:Cemip APN 7 83975055 missense probably damaging 0.99
IGL02979:Cemip APN 7 84003306 splice site probably benign
IGL03280:Cemip APN 7 83987330 splice site probably benign
IGL03400:Cemip APN 7 83958516 missense probably damaging 0.96
IGL03134:Cemip UTSW 7 83999237 missense probably damaging 1.00
R0149:Cemip UTSW 7 83964010 missense probably benign
R0212:Cemip UTSW 7 83973190 missense probably damaging 0.99
R0361:Cemip UTSW 7 83964010 missense probably benign
R0565:Cemip UTSW 7 83964110 missense probably damaging 0.99
R0727:Cemip UTSW 7 83961578 missense probably benign 0.00
R1342:Cemip UTSW 7 83944075 nonsense probably null
R1456:Cemip UTSW 7 83998510 missense possibly damaging 0.96
R1526:Cemip UTSW 7 83951440 missense probably damaging 1.00
R1676:Cemip UTSW 7 83964038 missense possibly damaging 0.77
R1718:Cemip UTSW 7 83935658 missense probably benign 0.00
R2234:Cemip UTSW 7 83998562 missense probably benign 0.02
R2513:Cemip UTSW 7 83942025 missense probably benign 0.11
R3788:Cemip UTSW 7 83943898 missense probably damaging 1.00
R3964:Cemip UTSW 7 83951509 missense probably benign 0.43
R3966:Cemip UTSW 7 83951509 missense probably benign 0.43
R4436:Cemip UTSW 7 83987429 missense probably null 0.43
R4584:Cemip UTSW 7 83958539 missense probably damaging 1.00
R4601:Cemip UTSW 7 83951618 missense probably damaging 0.98
R4717:Cemip UTSW 7 83947280 missense probably damaging 0.97
R4822:Cemip UTSW 7 83973241 missense probably benign 0.27
R4849:Cemip UTSW 7 83935737 missense possibly damaging 0.52
R4910:Cemip UTSW 7 83997411 missense probably damaging 1.00
R4911:Cemip UTSW 7 83983253 missense probably damaging 1.00
R4922:Cemip UTSW 7 83947100 intron probably benign
R4924:Cemip UTSW 7 83952938 missense probably damaging 1.00
R5090:Cemip UTSW 7 83942135 missense probably damaging 1.00
R5310:Cemip UTSW 7 83992033 missense probably damaging 1.00
R5327:Cemip UTSW 7 83955301 missense probably damaging 0.99
R5378:Cemip UTSW 7 83958525 missense probably damaging 1.00
R5444:Cemip UTSW 7 83982291 missense probably damaging 0.98
R5644:Cemip UTSW 7 83989184 missense probably benign 0.03
R5688:Cemip UTSW 7 83961641 missense probably damaging 1.00
R5714:Cemip UTSW 7 83975179 missense probably damaging 1.00
R6170:Cemip UTSW 7 83947230 missense possibly damaging 0.89
R6505:Cemip UTSW 7 83951597 nonsense probably null
R6713:Cemip UTSW 7 83943637 missense probably benign 0.03
R6767:Cemip UTSW 7 83998624 missense probably damaging 1.00
R6817:Cemip UTSW 7 83987992 missense probably damaging 1.00
R6896:Cemip UTSW 7 83998576 missense probably damaging 1.00
R6945:Cemip UTSW 7 83998547 missense probably damaging 1.00
T0970:Cemip UTSW 7 83983146 missense probably damaging 0.99
X0067:Cemip UTSW 7 83947208 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AATTGTCCCAGGCCAGATCTC -3'
(R):5'- ATTCAGTACAACCCAGTGACACTAG -3'

Sequencing Primer
(F):5'- TCCCAGGCCAGATCTCTAGGAG -3'
(R):5'- GTAATACCTCTGTCCTCTGGGAATG -3'
Posted On2015-12-21