Incidental Mutation 'R4767:Trpc6'
ID366218
Institutional Source Beutler Lab
Gene Symbol Trpc6
Ensembl Gene ENSMUSG00000031997
Gene Nametransient receptor potential cation channel, subfamily C, member 6
Synonymsmtrp6, Trrp6
MMRRC Submission 042408-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4767 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location8544142-8680741 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8643686 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 491 (S491P)
Ref Sequence ENSEMBL: ENSMUSP00000149686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050433] [ENSMUST00000214596]
Predicted Effect probably damaging
Transcript: ENSMUST00000050433
AA Change: S491P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000057965
Gene: ENSMUSG00000031997
AA Change: S491P

DomainStartEndE-ValueType
low complexity region 37 54 N/A INTRINSIC
ANK 96 125 4.73e2 SMART
ANK 131 159 3.49e0 SMART
ANK 217 246 6.61e-1 SMART
Pfam:TRP_2 252 314 4e-29 PFAM
transmembrane domain 406 427 N/A INTRINSIC
Pfam:Ion_trans 442 738 4.2e-38 PFAM
Pfam:PKD_channel 477 733 3.1e-16 PFAM
low complexity region 770 781 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000214596
AA Change: S491P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215328
Meta Mutation Damage Score 0.202 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a receptor-activated calcium channel in the cell membrane. The channel is activated by diacylglycerol and is thought to be under the control of a phosphatidylinositol second messenger system. Activation of this channel occurs independently of protein kinase C and is not triggered by low levels of intracellular calcium. Defects in this gene are a cause of focal segmental glomerulosclerosis 2 (FSGS2). [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for one null targeted mutation are viable and fertile and exhibit no overt abnormal phenotype. Another knockout results in an increase in thermal nociceptive response latency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 T C 11: 46,138,977 probably null Het
Aig1 T C 10: 13,801,858 N130S probably damaging Het
Alx1 A T 10: 103,025,186 Y160* probably null Het
Ap4e1 T C 2: 127,060,438 I755T probably benign Het
Apoc3 C A 9: 46,234,535 E21* probably null Het
Atp9b G T 18: 80,753,070 H919Q probably damaging Het
Cemip T G 7: 83,973,306 Y555S probably damaging Het
Cic T C 7: 25,271,600 V252A possibly damaging Het
Cracr2a A T 6: 127,611,507 N210Y probably damaging Het
Crocc2 G A 1: 93,202,856 R953Q possibly damaging Het
Csnk1d A G 11: 120,969,128 S318P probably benign Het
Ddx21 A G 10: 62,591,972 L384P probably damaging Het
Dnah5 C T 15: 28,270,474 T974I probably benign Het
Duox1 A G 2: 122,333,441 Y863C possibly damaging Het
Epg5 C A 18: 78,023,283 P2133T possibly damaging Het
Ephb6 A T 6: 41,614,185 Q92L possibly damaging Het
Ercc4 C A 16: 13,122,095 A73D probably damaging Het
Eva1c A T 16: 90,904,347 Y290F probably damaging Het
Galnt5 T A 2: 58,028,144 V798E possibly damaging Het
Haus4 T C 14: 54,548,885 E149G probably damaging Het
Ighv1-13 A G 12: 114,630,936 Y86C unknown Het
Igkv9-120 G T 6: 68,050,367 R88S possibly damaging Het
Lama3 T C 18: 12,500,563 V1584A probably benign Het
Lamb1 A G 12: 31,308,011 E1119G probably damaging Het
Lao1 T C 4: 118,967,988 L335P probably damaging Het
Mindy4 A G 6: 55,260,565 D375G probably damaging Het
Myo5a T C 9: 75,144,076 I317T probably damaging Het
Nhlrc2 G A 19: 56,570,466 V128I probably benign Het
Nlrp2 C T 7: 5,328,024 D458N probably damaging Het
Olfr107 T A 17: 37,406,200 C217* probably null Het
Olfr1497 A T 19: 13,795,045 C189S probably damaging Het
Olfr347 A T 2: 36,734,323 M1L probably benign Het
Olfr76 G T 19: 12,119,936 H247N probably damaging Het
Olfr938 T C 9: 39,078,692 T18A possibly damaging Het
Parp8 T C 13: 116,868,536 H663R probably damaging Het
Pax6 T C 2: 105,695,360 S377P probably benign Het
Pi15 A G 1: 17,602,766 D63G probably benign Het
Plaa A G 4: 94,586,258 probably benign Het
Rbm5 C A 9: 107,745,213 W546C probably damaging Het
Rnf123 C A 9: 108,052,089 C1257F probably damaging Het
Rnf185 A G 11: 3,432,551 S45P possibly damaging Het
Sh3bp1 T C 15: 78,904,497 S241P possibly damaging Het
Slfn8 G A 11: 83,003,197 A872V possibly damaging Het
Smoc1 G A 12: 81,104,773 probably null Het
Sox14 A T 9: 99,875,633 W18R probably damaging Het
Spata31d1a T C 13: 59,701,155 E1053G probably benign Het
Syne1 T A 10: 5,344,866 K1246* probably null Het
Tbrg4 A C 11: 6,620,909 S188A probably benign Het
Thnsl2 A T 6: 71,134,295 D196E probably damaging Het
Tmem266 C T 9: 55,380,741 T34I probably damaging Het
Tmem59l C A 8: 70,486,098 R111L probably benign Het
Tpr T C 1: 150,430,529 probably benign Het
Tspan10 A T 11: 120,446,166 N254I probably damaging Het
Ubox5 A T 2: 130,591,894 L511Q probably damaging Het
Vmn1r183 TATCCATC TATC 7: 24,055,106 probably null Het
Vmn2r4 C T 3: 64,390,976 C577Y probably damaging Het
Vmn2r86 A T 10: 130,455,737 M53K probably benign Het
Zfp948 T A 17: 21,588,307 I587N possibly damaging Het
Other mutations in Trpc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Trpc6 APN 9 8680438 missense probably damaging 1.00
IGL00469:Trpc6 APN 9 8626701 missense probably benign
IGL00970:Trpc6 APN 9 8653151 missense probably damaging 1.00
IGL01299:Trpc6 APN 9 8653061 missense probably damaging 1.00
IGL01563:Trpc6 APN 9 8656603 missense probably damaging 1.00
IGL01578:Trpc6 APN 9 8634057 missense probably damaging 1.00
IGL02657:Trpc6 APN 9 8643601 missense possibly damaging 0.94
IGL02735:Trpc6 APN 9 8655338 missense probably damaging 1.00
IGL03102:Trpc6 APN 9 8649301 missense probably benign 0.07
P0038:Trpc6 UTSW 9 8649511 missense possibly damaging 0.52
R0100:Trpc6 UTSW 9 8653034 missense probably damaging 1.00
R0100:Trpc6 UTSW 9 8653034 missense probably damaging 1.00
R0323:Trpc6 UTSW 9 8610275 missense probably damaging 1.00
R0323:Trpc6 UTSW 9 8643536 missense probably damaging 1.00
R0334:Trpc6 UTSW 9 8610343 missense probably damaging 1.00
R0665:Trpc6 UTSW 9 8634122 missense probably benign 0.11
R0948:Trpc6 UTSW 9 8610415 missense possibly damaging 0.60
R1177:Trpc6 UTSW 9 8658304 missense probably benign 0.04
R1217:Trpc6 UTSW 9 8658286 intron probably null
R1445:Trpc6 UTSW 9 8680537 missense probably benign 0.00
R1452:Trpc6 UTSW 9 8653147 missense probably damaging 0.99
R1494:Trpc6 UTSW 9 8658304 missense probably benign 0.04
R1501:Trpc6 UTSW 9 8610169 missense probably damaging 0.99
R1933:Trpc6 UTSW 9 8656545 missense probably damaging 1.00
R2112:Trpc6 UTSW 9 8656612 missense probably damaging 1.00
R2164:Trpc6 UTSW 9 8610465 nonsense probably null
R2921:Trpc6 UTSW 9 8653033 missense possibly damaging 0.94
R2995:Trpc6 UTSW 9 8544466 missense probably benign 0.30
R3821:Trpc6 UTSW 9 8610278 missense probably damaging 1.00
R3965:Trpc6 UTSW 9 8626621 missense probably damaging 1.00
R4360:Trpc6 UTSW 9 8610266 missense probably benign 0.10
R4625:Trpc6 UTSW 9 8677962 missense probably benign 0.40
R4691:Trpc6 UTSW 9 8652978 missense probably damaging 1.00
R4736:Trpc6 UTSW 9 8609870 missense probably damaging 1.00
R4773:Trpc6 UTSW 9 8609851 missense possibly damaging 0.78
R4792:Trpc6 UTSW 9 8626614 missense probably benign 0.00
R5105:Trpc6 UTSW 9 8649470 missense probably benign
R5319:Trpc6 UTSW 9 8609921 missense probably damaging 1.00
R5429:Trpc6 UTSW 9 8634074 nonsense probably null
R5505:Trpc6 UTSW 9 8626735 missense probably damaging 1.00
R5657:Trpc6 UTSW 9 8609807 missense probably benign 0.11
R5684:Trpc6 UTSW 9 8653128 missense probably damaging 1.00
R5722:Trpc6 UTSW 9 8680549 missense possibly damaging 0.88
R6210:Trpc6 UTSW 9 8656730 missense probably benign 0.42
R6284:Trpc6 UTSW 9 8643600 missense possibly damaging 0.93
R6773:Trpc6 UTSW 9 8634057 missense probably damaging 1.00
R6874:Trpc6 UTSW 9 8680438 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCGAGGACCGTTCATGAAG -3'
(R):5'- CAAACCACGCATGAGAGGTTC -3'

Sequencing Primer
(F):5'- CATGAAGTTTGTAGCACACGC -3'
(R):5'- TGTAACTGGTAATAAGGCCACC -3'
Posted On2015-12-21