Incidental Mutation 'R4767:Aig1'
ID366227
Institutional Source Beutler Lab
Gene Symbol Aig1
Ensembl Gene ENSMUSG00000019806
Gene Nameandrogen-induced 1
Synonyms1500031O19Rik, CGI-103
MMRRC Submission 042408-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.315) question?
Stock #R4767 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location13647054-13868980 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13801858 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 130 (N130S)
Ref Sequence ENSEMBL: ENSMUSP00000125366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019942] [ENSMUST00000105534] [ENSMUST00000162610]
Predicted Effect probably damaging
Transcript: ENSMUST00000019942
AA Change: N130S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019942
Gene: ENSMUSG00000019806
AA Change: N130S

DomainStartEndE-ValueType
Pfam:Far-17a_AIG1 12 219 5.6e-77 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105534
AA Change: N130S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101174
Gene: ENSMUSG00000019806
AA Change: N130S

DomainStartEndE-ValueType
Pfam:Far-17a_AIG1 12 178 3.4e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162174
Predicted Effect probably damaging
Transcript: ENSMUST00000162610
AA Change: N130S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125366
Gene: ENSMUSG00000019806
AA Change: N130S

DomainStartEndE-ValueType
Pfam:Far-17a_AIG1 12 219 5.4e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162798
Meta Mutation Damage Score 0.422 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 95% (62/65)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 T C 11: 46,138,977 probably null Het
Alx1 A T 10: 103,025,186 Y160* probably null Het
Ap4e1 T C 2: 127,060,438 I755T probably benign Het
Apoc3 C A 9: 46,234,535 E21* probably null Het
Atp9b G T 18: 80,753,070 H919Q probably damaging Het
Cemip T G 7: 83,973,306 Y555S probably damaging Het
Cic T C 7: 25,271,600 V252A possibly damaging Het
Cracr2a A T 6: 127,611,507 N210Y probably damaging Het
Crocc2 G A 1: 93,202,856 R953Q possibly damaging Het
Csnk1d A G 11: 120,969,128 S318P probably benign Het
Ddx21 A G 10: 62,591,972 L384P probably damaging Het
Dnah5 C T 15: 28,270,474 T974I probably benign Het
Duox1 A G 2: 122,333,441 Y863C possibly damaging Het
Epg5 C A 18: 78,023,283 P2133T possibly damaging Het
Ephb6 A T 6: 41,614,185 Q92L possibly damaging Het
Ercc4 C A 16: 13,122,095 A73D probably damaging Het
Eva1c A T 16: 90,904,347 Y290F probably damaging Het
Galnt5 T A 2: 58,028,144 V798E possibly damaging Het
Haus4 T C 14: 54,548,885 E149G probably damaging Het
Ighv1-13 A G 12: 114,630,936 Y86C unknown Het
Igkv9-120 G T 6: 68,050,367 R88S possibly damaging Het
Lama3 T C 18: 12,500,563 V1584A probably benign Het
Lamb1 A G 12: 31,308,011 E1119G probably damaging Het
Lao1 T C 4: 118,967,988 L335P probably damaging Het
Mindy4 A G 6: 55,260,565 D375G probably damaging Het
Myo5a T C 9: 75,144,076 I317T probably damaging Het
Nhlrc2 G A 19: 56,570,466 V128I probably benign Het
Nlrp2 C T 7: 5,328,024 D458N probably damaging Het
Olfr107 T A 17: 37,406,200 C217* probably null Het
Olfr1497 A T 19: 13,795,045 C189S probably damaging Het
Olfr347 A T 2: 36,734,323 M1L probably benign Het
Olfr76 G T 19: 12,119,936 H247N probably damaging Het
Olfr938 T C 9: 39,078,692 T18A possibly damaging Het
Parp8 T C 13: 116,868,536 H663R probably damaging Het
Pax6 T C 2: 105,695,360 S377P probably benign Het
Pi15 A G 1: 17,602,766 D63G probably benign Het
Plaa A G 4: 94,586,258 probably benign Het
Rbm5 C A 9: 107,745,213 W546C probably damaging Het
Rnf123 C A 9: 108,052,089 C1257F probably damaging Het
Rnf185 A G 11: 3,432,551 S45P possibly damaging Het
Sh3bp1 T C 15: 78,904,497 S241P possibly damaging Het
Slfn8 G A 11: 83,003,197 A872V possibly damaging Het
Smoc1 G A 12: 81,104,773 probably null Het
Sox14 A T 9: 99,875,633 W18R probably damaging Het
Spata31d1a T C 13: 59,701,155 E1053G probably benign Het
Syne1 T A 10: 5,344,866 K1246* probably null Het
Tbrg4 A C 11: 6,620,909 S188A probably benign Het
Thnsl2 A T 6: 71,134,295 D196E probably damaging Het
Tmem266 C T 9: 55,380,741 T34I probably damaging Het
Tmem59l C A 8: 70,486,098 R111L probably benign Het
Tpr T C 1: 150,430,529 probably benign Het
Trpc6 T C 9: 8,643,686 S491P probably damaging Het
Tspan10 A T 11: 120,446,166 N254I probably damaging Het
Ubox5 A T 2: 130,591,894 L511Q probably damaging Het
Vmn1r183 TATCCATC TATC 7: 24,055,106 probably null Het
Vmn2r4 C T 3: 64,390,976 C577Y probably damaging Het
Vmn2r86 A T 10: 130,455,737 M53K probably benign Het
Zfp948 T A 17: 21,588,307 I587N possibly damaging Het
Other mutations in Aig1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02343:Aig1 APN 10 13868674 missense probably damaging 0.99
IGL02715:Aig1 APN 10 13868616 critical splice donor site probably null
R0697:Aig1 UTSW 10 13829325 missense probably benign 0.01
R1699:Aig1 UTSW 10 13868622 missense possibly damaging 0.85
R1761:Aig1 UTSW 10 13690584 missense probably damaging 1.00
R3934:Aig1 UTSW 10 13801912 missense probably damaging 1.00
R4397:Aig1 UTSW 10 13652982 missense probably benign 0.00
R4736:Aig1 UTSW 10 13801930 missense probably damaging 0.97
R5081:Aig1 UTSW 10 13801900 missense probably benign 0.01
R5907:Aig1 UTSW 10 13801784 intron probably benign
X0018:Aig1 UTSW 10 13690524 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATTCATACAATGGCTCGGTTCC -3'
(R):5'- CTGCACTACTGCTGTCTTGG -3'

Sequencing Primer
(F):5'- ATACAATGGCTCGGTTCCACAGG -3'
(R):5'- GTCTTGGCATGAATTCCAAGC -3'
Posted On2015-12-21