Incidental Mutation 'R4767:Csnk1d'
ID366236
Institutional Source Beutler Lab
Gene Symbol Csnk1d
Ensembl Gene ENSMUSG00000025162
Gene Namecasein kinase 1, delta
Synonyms
MMRRC Submission 042408-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4767 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location120961749-120991330 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120969128 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 318 (S318P)
Ref Sequence ENSEMBL: ENSMUSP00000070721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018274] [ENSMUST00000070575]
Predicted Effect probably benign
Transcript: ENSMUST00000018274
AA Change: S318P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000018274
Gene: ENSMUSG00000025162
AA Change: S318P

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 9 273 3.7e-18 PFAM
Pfam:Pkinase 9 277 1.8e-28 PFAM
low complexity region 299 314 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070575
AA Change: S318P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000070721
Gene: ENSMUSG00000025162
AA Change: S318P

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 9 273 1.6e-18 PFAM
Pfam:Pkinase 9 280 2.8e-41 PFAM
low complexity region 299 314 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131375
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139267
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141071
Predicted Effect probably benign
Transcript: ENSMUST00000146837
SMART Domains Protein: ENSMUSP00000115055
Gene: ENSMUSG00000025162

DomainStartEndE-ValueType
Pfam:Pkinase 2 55 6.6e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154483
SMART Domains Protein: ENSMUSP00000117472
Gene: ENSMUSG00000025162

DomainStartEndE-ValueType
low complexity region 12 25 N/A INTRINSIC
Pfam:Pkinase_Tyr 27 210 2.5e-12 PFAM
Pfam:Pkinase 28 218 3.4e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189381
Meta Mutation Damage Score 0.042 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: This gene encodes a member of the casein kinase I (CKI) family of serine/threonine protein kinases. A highly similar human protein regulates an array of cellular processes by influencing the Wnt and hedgehog signaling pathways. The encoded protein may also be involved in the regulation of apoptosis, circadian rhythm, microtubule dynamics, chromosome segregation, and p53-mediated effects on growth. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice die 1.5 to 5 days after birth and fetal weight is significantly smaller than controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 T C 11: 46,138,977 probably null Het
Aig1 T C 10: 13,801,858 N130S probably damaging Het
Alx1 A T 10: 103,025,186 Y160* probably null Het
Ap4e1 T C 2: 127,060,438 I755T probably benign Het
Apoc3 C A 9: 46,234,535 E21* probably null Het
Atp9b G T 18: 80,753,070 H919Q probably damaging Het
Cemip T G 7: 83,973,306 Y555S probably damaging Het
Cic T C 7: 25,271,600 V252A possibly damaging Het
Cracr2a A T 6: 127,611,507 N210Y probably damaging Het
Crocc2 G A 1: 93,202,856 R953Q possibly damaging Het
Ddx21 A G 10: 62,591,972 L384P probably damaging Het
Dnah5 C T 15: 28,270,474 T974I probably benign Het
Duox1 A G 2: 122,333,441 Y863C possibly damaging Het
Epg5 C A 18: 78,023,283 P2133T possibly damaging Het
Ephb6 A T 6: 41,614,185 Q92L possibly damaging Het
Ercc4 C A 16: 13,122,095 A73D probably damaging Het
Eva1c A T 16: 90,904,347 Y290F probably damaging Het
Galnt5 T A 2: 58,028,144 V798E possibly damaging Het
Haus4 T C 14: 54,548,885 E149G probably damaging Het
Ighv1-13 A G 12: 114,630,936 Y86C unknown Het
Igkv9-120 G T 6: 68,050,367 R88S possibly damaging Het
Lama3 T C 18: 12,500,563 V1584A probably benign Het
Lamb1 A G 12: 31,308,011 E1119G probably damaging Het
Lao1 T C 4: 118,967,988 L335P probably damaging Het
Mindy4 A G 6: 55,260,565 D375G probably damaging Het
Myo5a T C 9: 75,144,076 I317T probably damaging Het
Nhlrc2 G A 19: 56,570,466 V128I probably benign Het
Nlrp2 C T 7: 5,328,024 D458N probably damaging Het
Olfr107 T A 17: 37,406,200 C217* probably null Het
Olfr1497 A T 19: 13,795,045 C189S probably damaging Het
Olfr347 A T 2: 36,734,323 M1L probably benign Het
Olfr76 G T 19: 12,119,936 H247N probably damaging Het
Olfr938 T C 9: 39,078,692 T18A possibly damaging Het
Parp8 T C 13: 116,868,536 H663R probably damaging Het
Pax6 T C 2: 105,695,360 S377P probably benign Het
Pi15 A G 1: 17,602,766 D63G probably benign Het
Plaa A G 4: 94,586,258 probably benign Het
Rbm5 C A 9: 107,745,213 W546C probably damaging Het
Rnf123 C A 9: 108,052,089 C1257F probably damaging Het
Rnf185 A G 11: 3,432,551 S45P possibly damaging Het
Sh3bp1 T C 15: 78,904,497 S241P possibly damaging Het
Slfn8 G A 11: 83,003,197 A872V possibly damaging Het
Smoc1 G A 12: 81,104,773 probably null Het
Sox14 A T 9: 99,875,633 W18R probably damaging Het
Spata31d1a T C 13: 59,701,155 E1053G probably benign Het
Syne1 T A 10: 5,344,866 K1246* probably null Het
Tbrg4 A C 11: 6,620,909 S188A probably benign Het
Thnsl2 A T 6: 71,134,295 D196E probably damaging Het
Tmem266 C T 9: 55,380,741 T34I probably damaging Het
Tmem59l C A 8: 70,486,098 R111L probably benign Het
Tpr T C 1: 150,430,529 probably benign Het
Trpc6 T C 9: 8,643,686 S491P probably damaging Het
Tspan10 A T 11: 120,446,166 N254I probably damaging Het
Ubox5 A T 2: 130,591,894 L511Q probably damaging Het
Vmn1r183 TATCCATC TATC 7: 24,055,106 probably null Het
Vmn2r4 C T 3: 64,390,976 C577Y probably damaging Het
Vmn2r86 A T 10: 130,455,737 M53K probably benign Het
Zfp948 T A 17: 21,588,307 I587N possibly damaging Het
Other mutations in Csnk1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01689:Csnk1d APN 11 120971567 missense probably benign 0.06
IGL01905:Csnk1d APN 11 120973963 missense probably damaging 1.00
IGL02476:Csnk1d APN 11 120972512 missense probably damaging 1.00
R1971:Csnk1d UTSW 11 120972448 missense possibly damaging 0.95
R2245:Csnk1d UTSW 11 120972403 missense probably damaging 1.00
R4472:Csnk1d UTSW 11 120964974 unclassified probably benign
R4809:Csnk1d UTSW 11 120963842 unclassified probably benign
R4870:Csnk1d UTSW 11 120983188 intron probably benign
R6522:Csnk1d UTSW 11 120971623 missense probably damaging 1.00
R6657:Csnk1d UTSW 11 120964994 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- TGGTTAGCAATTCATCAACACAGC -3'
(R):5'- GGAGACTTCAAAGGGCACTC -3'

Sequencing Primer
(F):5'- CACAGCAAACAGAGGTCCTAGTTTG -3'
(R):5'- CATTACAGATGGTTGTGAGCCACC -3'
Posted On2015-12-21