Incidental Mutation 'R4767:Smoc1'
ID366238
Institutional Source Beutler Lab
Gene Symbol Smoc1
Ensembl Gene ENSMUSG00000021136
Gene NameSPARC related modular calcium binding 1
Synonyms2600002F22Rik, SPARC-related protein, SRG
MMRRC Submission 042408-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4767 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location81026808-81186414 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 81104773 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021564] [ENSMUST00000110347] [ENSMUST00000129362]
Predicted Effect probably null
Transcript: ENSMUST00000021564
SMART Domains Protein: ENSMUSP00000021564
Gene: ENSMUSG00000021136

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
KAZAL 41 86 6.91e-8 SMART
TY 114 161 8.41e-12 SMART
TY 247 295 1.79e-15 SMART
Pfam:SPARC_Ca_bdg 311 423 1.6e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110347
SMART Domains Protein: ENSMUSP00000105976
Gene: ENSMUSG00000021136

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
KAZAL 41 86 6.91e-8 SMART
TY 114 161 8.41e-12 SMART
TY 258 306 1.79e-15 SMART
Pfam:SPARC_Ca_bdg 323 434 2e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000129362
SMART Domains Protein: ENSMUSP00000122858
Gene: ENSMUSG00000021136

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
KAZAL 41 86 6.91e-8 SMART
TY 114 161 8.41e-12 SMART
TY 247 295 1.79e-15 SMART
Pfam:SPARC_Ca_bdg 311 423 1.5e-14 PFAM
Meta Mutation Damage Score 0.586 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain secreted protein that may have a critical role in ocular and limb development. Mutations in this gene are associated with microphthalmia and limb anomalies. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a transposon-induced allele exhibit ocular and limb defects. Mice homozygous for a knock-out allele exhibit neonatal lethality, osseous syndactyly, decreased body size, and iris and retina coloboma. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 T C 11: 46,138,977 probably null Het
Aig1 T C 10: 13,801,858 N130S probably damaging Het
Alx1 A T 10: 103,025,186 Y160* probably null Het
Ap4e1 T C 2: 127,060,438 I755T probably benign Het
Apoc3 C A 9: 46,234,535 E21* probably null Het
Atp9b G T 18: 80,753,070 H919Q probably damaging Het
Cemip T G 7: 83,973,306 Y555S probably damaging Het
Cic T C 7: 25,271,600 V252A possibly damaging Het
Cracr2a A T 6: 127,611,507 N210Y probably damaging Het
Crocc2 G A 1: 93,202,856 R953Q possibly damaging Het
Csnk1d A G 11: 120,969,128 S318P probably benign Het
Ddx21 A G 10: 62,591,972 L384P probably damaging Het
Dnah5 C T 15: 28,270,474 T974I probably benign Het
Duox1 A G 2: 122,333,441 Y863C possibly damaging Het
Epg5 C A 18: 78,023,283 P2133T possibly damaging Het
Ephb6 A T 6: 41,614,185 Q92L possibly damaging Het
Ercc4 C A 16: 13,122,095 A73D probably damaging Het
Eva1c A T 16: 90,904,347 Y290F probably damaging Het
Galnt5 T A 2: 58,028,144 V798E possibly damaging Het
Haus4 T C 14: 54,548,885 E149G probably damaging Het
Ighv1-13 A G 12: 114,630,936 Y86C unknown Het
Igkv9-120 G T 6: 68,050,367 R88S possibly damaging Het
Lama3 T C 18: 12,500,563 V1584A probably benign Het
Lamb1 A G 12: 31,308,011 E1119G probably damaging Het
Lao1 T C 4: 118,967,988 L335P probably damaging Het
Mindy4 A G 6: 55,260,565 D375G probably damaging Het
Myo5a T C 9: 75,144,076 I317T probably damaging Het
Nhlrc2 G A 19: 56,570,466 V128I probably benign Het
Nlrp2 C T 7: 5,328,024 D458N probably damaging Het
Olfr107 T A 17: 37,406,200 C217* probably null Het
Olfr1497 A T 19: 13,795,045 C189S probably damaging Het
Olfr347 A T 2: 36,734,323 M1L probably benign Het
Olfr76 G T 19: 12,119,936 H247N probably damaging Het
Olfr938 T C 9: 39,078,692 T18A possibly damaging Het
Parp8 T C 13: 116,868,536 H663R probably damaging Het
Pax6 T C 2: 105,695,360 S377P probably benign Het
Pi15 A G 1: 17,602,766 D63G probably benign Het
Plaa A G 4: 94,586,258 probably benign Het
Rbm5 C A 9: 107,745,213 W546C probably damaging Het
Rnf123 C A 9: 108,052,089 C1257F probably damaging Het
Rnf185 A G 11: 3,432,551 S45P possibly damaging Het
Sh3bp1 T C 15: 78,904,497 S241P possibly damaging Het
Slfn8 G A 11: 83,003,197 A872V possibly damaging Het
Sox14 A T 9: 99,875,633 W18R probably damaging Het
Spata31d1a T C 13: 59,701,155 E1053G probably benign Het
Syne1 T A 10: 5,344,866 K1246* probably null Het
Tbrg4 A C 11: 6,620,909 S188A probably benign Het
Thnsl2 A T 6: 71,134,295 D196E probably damaging Het
Tmem266 C T 9: 55,380,741 T34I probably damaging Het
Tmem59l C A 8: 70,486,098 R111L probably benign Het
Tpr T C 1: 150,430,529 probably benign Het
Trpc6 T C 9: 8,643,686 S491P probably damaging Het
Tspan10 A T 11: 120,446,166 N254I probably damaging Het
Ubox5 A T 2: 130,591,894 L511Q probably damaging Het
Vmn1r183 TATCCATC TATC 7: 24,055,106 probably null Het
Vmn2r4 C T 3: 64,390,976 C577Y probably damaging Het
Vmn2r86 A T 10: 130,455,737 M53K probably benign Het
Zfp948 T A 17: 21,588,307 I587N possibly damaging Het
Other mutations in Smoc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01431:Smoc1 APN 12 81152751 nonsense probably null
R1291:Smoc1 UTSW 12 81179591 missense probably damaging 0.97
R1902:Smoc1 UTSW 12 81104671 missense probably benign 0.32
R2109:Smoc1 UTSW 12 81150676 missense probably damaging 0.99
R2567:Smoc1 UTSW 12 81167590 missense probably damaging 0.99
R3900:Smoc1 UTSW 12 81167513 missense probably damaging 0.98
R4663:Smoc1 UTSW 12 81167602 missense probably damaging 1.00
R4762:Smoc1 UTSW 12 81167651 missense probably damaging 1.00
R4836:Smoc1 UTSW 12 81179548 missense probably damaging 1.00
R5264:Smoc1 UTSW 12 81104700 missense probably damaging 0.99
R5839:Smoc1 UTSW 12 81167585 missense probably damaging 1.00
R5898:Smoc1 UTSW 12 81104757 nonsense probably null
V8831:Smoc1 UTSW 12 81168255 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTACTAACTAAGGGGAAGCCAAGAC -3'
(R):5'- TGGCAGTGTCTGAAGATCAGG -3'

Sequencing Primer
(F):5'- GACTATAAGTCATGGGTCTCTCC -3'
(R):5'- TCTGAAGATCAGGGAAGTGTTC -3'
Posted On2015-12-21