Incidental Mutation 'R4767:Sh3bp1'
ID366243
Institutional Source Beutler Lab
Gene Symbol Sh3bp1
Ensembl Gene ENSMUSG00000022436
Gene NameSH3-domain binding protein 1
Synonyms3BP-1
MMRRC Submission 042408-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R4767 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location78899768-78912051 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78904497 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 241 (S241P)
Ref Sequence ENSEMBL: ENSMUSP00000001226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001226] [ENSMUST00000061239] [ENSMUST00000109698] [ENSMUST00000132047] [ENSMUST00000134703] [ENSMUST00000148893] [ENSMUST00000151146]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001226
AA Change: S241P

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000001226
Gene: ENSMUSG00000022436
AA Change: S241P

DomainStartEndE-ValueType
Pfam:BAR 2 254 7e-37 PFAM
RhoGAP 287 466 2.04e-63 SMART
low complexity region 500 518 N/A INTRINSIC
low complexity region 558 593 N/A INTRINSIC
low complexity region 604 633 N/A INTRINSIC
low complexity region 661 672 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000061239
AA Change: S241P

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000052181
Gene: ENSMUSG00000022436
AA Change: S241P

DomainStartEndE-ValueType
Pfam:BAR 2 254 2.2e-36 PFAM
RhoGAP 287 466 2.04e-63 SMART
low complexity region 500 518 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109698
AA Change: S241P

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105320
Gene: ENSMUSG00000022436
AA Change: S241P

DomainStartEndE-ValueType
Pfam:BAR 2 254 2.2e-36 PFAM
RhoGAP 287 466 2.04e-63 SMART
low complexity region 500 518 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000132047
AA Change: S241P

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000138598
Gene: ENSMUSG00000022436
AA Change: S241P

DomainStartEndE-ValueType
Pfam:BAR 2 254 5.4e-36 PFAM
RhoGAP 287 466 2.04e-63 SMART
low complexity region 500 518 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134703
AA Change: S177P

PolyPhen 2 Score 0.219 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000148893
SMART Domains Protein: ENSMUSP00000117839
Gene: ENSMUSG00000022436

DomainStartEndE-ValueType
Blast:BAR 2 55 1e-5 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000151146
SMART Domains Protein: ENSMUSP00000138780
Gene: ENSMUSG00000022436

DomainStartEndE-ValueType
Pfam:BAR 2 143 9e-22 PFAM
low complexity region 160 177 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229492
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229803
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231057
Meta Mutation Damage Score 0.17 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 95% (62/65)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 T C 11: 46,138,977 probably null Het
Aig1 T C 10: 13,801,858 N130S probably damaging Het
Alx1 A T 10: 103,025,186 Y160* probably null Het
Ap4e1 T C 2: 127,060,438 I755T probably benign Het
Apoc3 C A 9: 46,234,535 E21* probably null Het
Atp9b G T 18: 80,753,070 H919Q probably damaging Het
Cemip T G 7: 83,973,306 Y555S probably damaging Het
Cic T C 7: 25,271,600 V252A possibly damaging Het
Cracr2a A T 6: 127,611,507 N210Y probably damaging Het
Crocc2 G A 1: 93,202,856 R953Q possibly damaging Het
Csnk1d A G 11: 120,969,128 S318P probably benign Het
Ddx21 A G 10: 62,591,972 L384P probably damaging Het
Dnah5 C T 15: 28,270,474 T974I probably benign Het
Duox1 A G 2: 122,333,441 Y863C possibly damaging Het
Epg5 C A 18: 78,023,283 P2133T possibly damaging Het
Ephb6 A T 6: 41,614,185 Q92L possibly damaging Het
Ercc4 C A 16: 13,122,095 A73D probably damaging Het
Eva1c A T 16: 90,904,347 Y290F probably damaging Het
Galnt5 T A 2: 58,028,144 V798E possibly damaging Het
Haus4 T C 14: 54,548,885 E149G probably damaging Het
Ighv1-13 A G 12: 114,630,936 Y86C unknown Het
Igkv9-120 G T 6: 68,050,367 R88S possibly damaging Het
Lama3 T C 18: 12,500,563 V1584A probably benign Het
Lamb1 A G 12: 31,308,011 E1119G probably damaging Het
Lao1 T C 4: 118,967,988 L335P probably damaging Het
Mindy4 A G 6: 55,260,565 D375G probably damaging Het
Myo5a T C 9: 75,144,076 I317T probably damaging Het
Nhlrc2 G A 19: 56,570,466 V128I probably benign Het
Nlrp2 C T 7: 5,328,024 D458N probably damaging Het
Olfr107 T A 17: 37,406,200 C217* probably null Het
Olfr1497 A T 19: 13,795,045 C189S probably damaging Het
Olfr347 A T 2: 36,734,323 M1L probably benign Het
Olfr76 G T 19: 12,119,936 H247N probably damaging Het
Olfr938 T C 9: 39,078,692 T18A possibly damaging Het
Parp8 T C 13: 116,868,536 H663R probably damaging Het
Pax6 T C 2: 105,695,360 S377P probably benign Het
Pi15 A G 1: 17,602,766 D63G probably benign Het
Plaa A G 4: 94,586,258 probably benign Het
Rbm5 C A 9: 107,745,213 W546C probably damaging Het
Rnf123 C A 9: 108,052,089 C1257F probably damaging Het
Rnf185 A G 11: 3,432,551 S45P possibly damaging Het
Slfn8 G A 11: 83,003,197 A872V possibly damaging Het
Smoc1 G A 12: 81,104,773 probably null Het
Sox14 A T 9: 99,875,633 W18R probably damaging Het
Spata31d1a T C 13: 59,701,155 E1053G probably benign Het
Syne1 T A 10: 5,344,866 K1246* probably null Het
Tbrg4 A C 11: 6,620,909 S188A probably benign Het
Thnsl2 A T 6: 71,134,295 D196E probably damaging Het
Tmem266 C T 9: 55,380,741 T34I probably damaging Het
Tmem59l C A 8: 70,486,098 R111L probably benign Het
Tpr T C 1: 150,430,529 probably benign Het
Trpc6 T C 9: 8,643,686 S491P probably damaging Het
Tspan10 A T 11: 120,446,166 N254I probably damaging Het
Ubox5 A T 2: 130,591,894 L511Q probably damaging Het
Vmn1r183 TATCCATC TATC 7: 24,055,106 probably null Het
Vmn2r4 C T 3: 64,390,976 C577Y probably damaging Het
Vmn2r86 A T 10: 130,455,737 M53K probably benign Het
Zfp948 T A 17: 21,588,307 I587N possibly damaging Het
Other mutations in Sh3bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Sh3bp1 APN 15 78905114 missense possibly damaging 0.58
IGL01879:Sh3bp1 APN 15 78907992 missense probably damaging 1.00
IGL02112:Sh3bp1 APN 15 78905884 critical splice donor site probably null
IGL02216:Sh3bp1 APN 15 78905164 missense probably benign 0.07
IGL02385:Sh3bp1 APN 15 78905888 splice site probably benign
IGL02417:Sh3bp1 APN 15 78901499 missense probably damaging 1.00
IGL02551:Sh3bp1 APN 15 78904338 missense probably benign 0.01
PIT1430001:Sh3bp1 UTSW 15 78914024 missense probably benign
R0255:Sh3bp1 UTSW 15 78904334 nonsense probably null
R0318:Sh3bp1 UTSW 15 78911707 missense probably damaging 0.97
R0544:Sh3bp1 UTSW 15 78905775 missense probably damaging 1.00
R0554:Sh3bp1 UTSW 15 78907267 missense probably damaging 1.00
R1424:Sh3bp1 UTSW 15 78903699 critical splice donor site probably null
R1465:Sh3bp1 UTSW 15 78907345 splice site probably benign
R1813:Sh3bp1 UTSW 15 78903680 missense probably damaging 0.96
R1835:Sh3bp1 UTSW 15 78905150 missense probably damaging 1.00
R2291:Sh3bp1 UTSW 15 78918319 missense possibly damaging 0.93
R2415:Sh3bp1 UTSW 15 78901161 start gained probably benign
R2509:Sh3bp1 UTSW 15 78911506 missense probably damaging 1.00
R2511:Sh3bp1 UTSW 15 78911506 missense probably damaging 1.00
R3054:Sh3bp1 UTSW 15 78911422 missense probably benign 0.01
R3827:Sh3bp1 UTSW 15 78904497 missense possibly damaging 0.67
R3855:Sh3bp1 UTSW 15 78901161 start gained probably benign
R4787:Sh3bp1 UTSW 15 78907995 missense possibly damaging 0.80
R4852:Sh3bp1 UTSW 15 78904338 missense probably benign 0.01
R4872:Sh3bp1 UTSW 15 78908037 missense probably benign 0.31
R5194:Sh3bp1 UTSW 15 78903101 missense probably damaging 1.00
R6320:Sh3bp1 UTSW 15 78911515 missense probably damaging 1.00
R6322:Sh3bp1 UTSW 15 78911515 missense probably damaging 1.00
R6569:Sh3bp1 UTSW 15 78911696 missense probably damaging 1.00
R6678:Sh3bp1 UTSW 15 78908514 critical splice donor site probably null
R6905:Sh3bp1 UTSW 15 78905030 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACCAAGGAGGATTCTTATGCC -3'
(R):5'- ATTCAACCATAGCTCCCTACTG -3'

Sequencing Primer
(F):5'- CAAGGAGGATTCTTATGCCAACTAC -3'
(R):5'- AACTCTCTATGGAGACTAGGCTGC -3'
Posted On2015-12-21