Incidental Mutation 'R4767:Eva1c'
ID366245
Institutional Source Beutler Lab
Gene Symbol Eva1c
Ensembl Gene ENSMUSG00000039903
Gene Nameeva-1 homolog C (C. elegans)
Synonyms
MMRRC Submission 042408-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.037) question?
Stock #R4767 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location90826719-90905109 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 90904347 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 290 (Y290F)
Ref Sequence ENSEMBL: ENSMUSP00000156225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037539] [ENSMUST00000099543] [ENSMUST00000099548] [ENSMUST00000130868] [ENSMUST00000152223] [ENSMUST00000231280] [ENSMUST00000231964]
Predicted Effect probably damaging
Transcript: ENSMUST00000037539
AA Change: Y397F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000036695
Gene: ENSMUSG00000039903
AA Change: Y397F

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Pfam:Gal_Lectin 75 158 1.8e-22 PFAM
Pfam:Gal_Lectin 176 259 2e-21 PFAM
Pfam:FAM176 300 440 3e-59 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099543
AA Change: Y349F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097141
Gene: ENSMUSG00000039903
AA Change: Y349F

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Pfam:Gal_Lectin 75 158 4.9e-20 PFAM
internal_repeat_1 163 203 8.79e-5 PROSPERO
Pfam:FAM176 252 392 5.8e-52 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099548
AA Change: Y403F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097145
Gene: ENSMUSG00000039903
AA Change: Y403F

DomainStartEndE-ValueType
Pfam:Gal_Lectin 1 63 1.5e-12 PFAM
Pfam:Gal_Lectin 81 164 6.5e-21 PFAM
Pfam:FAM176 205 345 1.1e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130868
SMART Domains Protein: ENSMUSP00000121430
Gene: ENSMUSG00000039903

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152223
SMART Domains Protein: ENSMUSP00000119510
Gene: ENSMUSG00000039903

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000231280
AA Change: Y290F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000231964
AA Change: Y302F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232665
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 95% (62/65)
MGI Phenotype PHENOTYPE: Homozygous mice exhibit an abnormal pupilary reflex in response to dilating drugs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 T C 11: 46,138,977 probably null Het
Aig1 T C 10: 13,801,858 N130S probably damaging Het
Alx1 A T 10: 103,025,186 Y160* probably null Het
Ap4e1 T C 2: 127,060,438 I755T probably benign Het
Apoc3 C A 9: 46,234,535 E21* probably null Het
Atp9b G T 18: 80,753,070 H919Q probably damaging Het
Cemip T G 7: 83,973,306 Y555S probably damaging Het
Cic T C 7: 25,271,600 V252A possibly damaging Het
Cracr2a A T 6: 127,611,507 N210Y probably damaging Het
Crocc2 G A 1: 93,202,856 R953Q possibly damaging Het
Csnk1d A G 11: 120,969,128 S318P probably benign Het
Ddx21 A G 10: 62,591,972 L384P probably damaging Het
Dnah5 C T 15: 28,270,474 T974I probably benign Het
Duox1 A G 2: 122,333,441 Y863C possibly damaging Het
Epg5 C A 18: 78,023,283 P2133T possibly damaging Het
Ephb6 A T 6: 41,614,185 Q92L possibly damaging Het
Ercc4 C A 16: 13,122,095 A73D probably damaging Het
Galnt5 T A 2: 58,028,144 V798E possibly damaging Het
Haus4 T C 14: 54,548,885 E149G probably damaging Het
Ighv1-13 A G 12: 114,630,936 Y86C unknown Het
Igkv9-120 G T 6: 68,050,367 R88S possibly damaging Het
Lama3 T C 18: 12,500,563 V1584A probably benign Het
Lamb1 A G 12: 31,308,011 E1119G probably damaging Het
Lao1 T C 4: 118,967,988 L335P probably damaging Het
Mindy4 A G 6: 55,260,565 D375G probably damaging Het
Myo5a T C 9: 75,144,076 I317T probably damaging Het
Nhlrc2 G A 19: 56,570,466 V128I probably benign Het
Nlrp2 C T 7: 5,328,024 D458N probably damaging Het
Olfr107 T A 17: 37,406,200 C217* probably null Het
Olfr1497 A T 19: 13,795,045 C189S probably damaging Het
Olfr347 A T 2: 36,734,323 M1L probably benign Het
Olfr76 G T 19: 12,119,936 H247N probably damaging Het
Olfr938 T C 9: 39,078,692 T18A possibly damaging Het
Parp8 T C 13: 116,868,536 H663R probably damaging Het
Pax6 T C 2: 105,695,360 S377P probably benign Het
Pi15 A G 1: 17,602,766 D63G probably benign Het
Plaa A G 4: 94,586,258 probably benign Het
Rbm5 C A 9: 107,745,213 W546C probably damaging Het
Rnf123 C A 9: 108,052,089 C1257F probably damaging Het
Rnf185 A G 11: 3,432,551 S45P possibly damaging Het
Sh3bp1 T C 15: 78,904,497 S241P possibly damaging Het
Slfn8 G A 11: 83,003,197 A872V possibly damaging Het
Smoc1 G A 12: 81,104,773 probably null Het
Sox14 A T 9: 99,875,633 W18R probably damaging Het
Spata31d1a T C 13: 59,701,155 E1053G probably benign Het
Syne1 T A 10: 5,344,866 K1246* probably null Het
Tbrg4 A C 11: 6,620,909 S188A probably benign Het
Thnsl2 A T 6: 71,134,295 D196E probably damaging Het
Tmem266 C T 9: 55,380,741 T34I probably damaging Het
Tmem59l C A 8: 70,486,098 R111L probably benign Het
Tpr T C 1: 150,430,529 probably benign Het
Trpc6 T C 9: 8,643,686 S491P probably damaging Het
Tspan10 A T 11: 120,446,166 N254I probably damaging Het
Ubox5 A T 2: 130,591,894 L511Q probably damaging Het
Vmn1r183 TATCCATC TATC 7: 24,055,106 probably null Het
Vmn2r4 C T 3: 64,390,976 C577Y probably damaging Het
Vmn2r86 A T 10: 130,455,737 M53K probably benign Het
Zfp948 T A 17: 21,588,307 I587N possibly damaging Het
Other mutations in Eva1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01710:Eva1c APN 16 90904347 missense probably damaging 1.00
IGL02061:Eva1c APN 16 90866275 nonsense probably null
R0067:Eva1c UTSW 16 90866417 missense possibly damaging 0.65
R0067:Eva1c UTSW 16 90866417 missense possibly damaging 0.65
R0455:Eva1c UTSW 16 90876098 missense probably benign 0.03
R1330:Eva1c UTSW 16 90904396 missense probably damaging 1.00
R1765:Eva1c UTSW 16 90904247 missense probably benign 0.01
R1824:Eva1c UTSW 16 90866443 missense probably benign 0.01
R1880:Eva1c UTSW 16 90897415 missense possibly damaging 0.75
R2248:Eva1c UTSW 16 90831325 missense probably benign 0.12
R4072:Eva1c UTSW 16 90904131 missense probably damaging 1.00
R4076:Eva1c UTSW 16 90904131 missense probably damaging 1.00
R4622:Eva1c UTSW 16 90897455 critical splice donor site probably null
R4760:Eva1c UTSW 16 90904250 missense probably benign 0.37
R5024:Eva1c UTSW 16 90876193 critical splice donor site probably null
R5304:Eva1c UTSW 16 90869663 missense probably damaging 1.00
R5559:Eva1c UTSW 16 90904251 missense probably benign 0.06
R6605:Eva1c UTSW 16 90866348 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCATGTCCAGTGTCTGCATC -3'
(R):5'- GACCCTTCCTTCTTCAGAGAG -3'

Sequencing Primer
(F):5'- ACTGTGTGCCCTGGTCATCAG -3'
(R):5'- AGAGAGTCTGATCTCCTCCAGATG -3'
Posted On2015-12-21