Incidental Mutation 'R4767:Olfr76'
ID366251
Institutional Source Beutler Lab
Gene Symbol Olfr76
Ensembl Gene ENSMUSG00000067522
Gene Nameolfactory receptor 76
SynonymsMOR215-3, V5, GA_x6K02T2RE5P-2479601-2478648
MMRRC Submission 042408-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock #R4767 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location12117996-12123203 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 12119936 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 247 (H247N)
Ref Sequence ENSEMBL: ENSMUSP00000149014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087822] [ENSMUST00000208391] [ENSMUST00000213471] [ENSMUST00000214103] [ENSMUST00000214676]
Predicted Effect probably damaging
Transcript: ENSMUST00000087822
AA Change: H247N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085124
Gene: ENSMUSG00000067522
AA Change: H247N

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 9.2e-54 PFAM
Pfam:7tm_1 44 293 5.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208391
Predicted Effect probably damaging
Transcript: ENSMUST00000213471
AA Change: H259N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000214103
Predicted Effect probably damaging
Transcript: ENSMUST00000214676
AA Change: H247N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216205
Meta Mutation Damage Score 0.342 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 T C 11: 46,138,977 probably null Het
Aig1 T C 10: 13,801,858 N130S probably damaging Het
Alx1 A T 10: 103,025,186 Y160* probably null Het
Ap4e1 T C 2: 127,060,438 I755T probably benign Het
Apoc3 C A 9: 46,234,535 E21* probably null Het
Atp9b G T 18: 80,753,070 H919Q probably damaging Het
Cemip T G 7: 83,973,306 Y555S probably damaging Het
Cic T C 7: 25,271,600 V252A possibly damaging Het
Cracr2a A T 6: 127,611,507 N210Y probably damaging Het
Crocc2 G A 1: 93,202,856 R953Q possibly damaging Het
Csnk1d A G 11: 120,969,128 S318P probably benign Het
Ddx21 A G 10: 62,591,972 L384P probably damaging Het
Dnah5 C T 15: 28,270,474 T974I probably benign Het
Duox1 A G 2: 122,333,441 Y863C possibly damaging Het
Epg5 C A 18: 78,023,283 P2133T possibly damaging Het
Ephb6 A T 6: 41,614,185 Q92L possibly damaging Het
Ercc4 C A 16: 13,122,095 A73D probably damaging Het
Eva1c A T 16: 90,904,347 Y290F probably damaging Het
Galnt5 T A 2: 58,028,144 V798E possibly damaging Het
Haus4 T C 14: 54,548,885 E149G probably damaging Het
Ighv1-13 A G 12: 114,630,936 Y86C unknown Het
Igkv9-120 G T 6: 68,050,367 R88S possibly damaging Het
Lama3 T C 18: 12,500,563 V1584A probably benign Het
Lamb1 A G 12: 31,308,011 E1119G probably damaging Het
Lao1 T C 4: 118,967,988 L335P probably damaging Het
Mindy4 A G 6: 55,260,565 D375G probably damaging Het
Myo5a T C 9: 75,144,076 I317T probably damaging Het
Nhlrc2 G A 19: 56,570,466 V128I probably benign Het
Nlrp2 C T 7: 5,328,024 D458N probably damaging Het
Olfr107 T A 17: 37,406,200 C217* probably null Het
Olfr1497 A T 19: 13,795,045 C189S probably damaging Het
Olfr347 A T 2: 36,734,323 M1L probably benign Het
Olfr938 T C 9: 39,078,692 T18A possibly damaging Het
Parp8 T C 13: 116,868,536 H663R probably damaging Het
Pax6 T C 2: 105,695,360 S377P probably benign Het
Pi15 A G 1: 17,602,766 D63G probably benign Het
Plaa A G 4: 94,586,258 probably benign Het
Rbm5 C A 9: 107,745,213 W546C probably damaging Het
Rnf123 C A 9: 108,052,089 C1257F probably damaging Het
Rnf185 A G 11: 3,432,551 S45P possibly damaging Het
Sh3bp1 T C 15: 78,904,497 S241P possibly damaging Het
Slfn8 G A 11: 83,003,197 A872V possibly damaging Het
Smoc1 G A 12: 81,104,773 probably null Het
Sox14 A T 9: 99,875,633 W18R probably damaging Het
Spata31d1a T C 13: 59,701,155 E1053G probably benign Het
Syne1 T A 10: 5,344,866 K1246* probably null Het
Tbrg4 A C 11: 6,620,909 S188A probably benign Het
Thnsl2 A T 6: 71,134,295 D196E probably damaging Het
Tmem266 C T 9: 55,380,741 T34I probably damaging Het
Tmem59l C A 8: 70,486,098 R111L probably benign Het
Tpr T C 1: 150,430,529 probably benign Het
Trpc6 T C 9: 8,643,686 S491P probably damaging Het
Tspan10 A T 11: 120,446,166 N254I probably damaging Het
Ubox5 A T 2: 130,591,894 L511Q probably damaging Het
Vmn1r183 TATCCATC TATC 7: 24,055,106 probably null Het
Vmn2r4 C T 3: 64,390,976 C577Y probably damaging Het
Vmn2r86 A T 10: 130,455,737 M53K probably benign Het
Zfp948 T A 17: 21,588,307 I587N possibly damaging Het
Other mutations in Olfr76
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Olfr76 APN 19 12119876 missense probably damaging 1.00
IGL01693:Olfr76 APN 19 12120557 missense probably benign
R0360:Olfr76 UTSW 19 12119853 missense possibly damaging 0.84
R0399:Olfr76 UTSW 19 12120370 missense possibly damaging 0.67
R0467:Olfr76 UTSW 19 12120536 missense probably benign 0.01
R0750:Olfr76 UTSW 19 12120713 splice site probably null
R1432:Olfr76 UTSW 19 12120239 missense possibly damaging 0.56
R1535:Olfr76 UTSW 19 12120332 missense probably damaging 1.00
R4739:Olfr76 UTSW 19 12119870 missense possibly damaging 0.65
R5032:Olfr76 UTSW 19 12120056 missense probably benign 0.00
R5367:Olfr76 UTSW 19 12120436 missense possibly damaging 0.90
R6363:Olfr76 UTSW 19 12120166 missense possibly damaging 0.60
R6426:Olfr76 UTSW 19 12119848 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TCCACAGGGCATCTTTGATTTC -3'
(R):5'- CGGGCCAAATGTCATCAACC -3'

Sequencing Primer
(F):5'- ACAGGGCATCTTTGATTTCTTTGTTC -3'
(R):5'- AAATGTCATCAACCACTTCTTCTGTG -3'
Posted On2015-12-21