Incidental Mutation 'R4767:Nhlrc2'
ID366253
Institutional Source Beutler Lab
Gene Symbol Nhlrc2
Ensembl Gene ENSMUSG00000025078
Gene NameNHL repeat containing 2
Synonyms
MMRRC Submission 042408-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.884) question?
Stock #R4767 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location56548261-56598846 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 56570466 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 128 (V128I)
Ref Sequence ENSEMBL: ENSMUSP00000071370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071423]
Predicted Effect probably benign
Transcript: ENSMUST00000071423
AA Change: V128I

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000071370
Gene: ENSMUSG00000025078
AA Change: V128I

DomainStartEndE-ValueType
Pfam:Thioredoxin_8 78 174 2.7e-14 PFAM
LY 216 258 8.44e0 SMART
Pfam:NHL 278 304 2.3e-9 PFAM
low complexity region 321 331 N/A INTRINSIC
Blast:LY 402 446 5e-8 BLAST
LY 467 509 1.91e0 SMART
Pfam:NHL 530 558 1.2e-9 PFAM
Meta Mutation Damage Score 0.042 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 95% (62/65)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 T C 11: 46,138,977 probably null Het
Aig1 T C 10: 13,801,858 N130S probably damaging Het
Alx1 A T 10: 103,025,186 Y160* probably null Het
Ap4e1 T C 2: 127,060,438 I755T probably benign Het
Apoc3 C A 9: 46,234,535 E21* probably null Het
Atp9b G T 18: 80,753,070 H919Q probably damaging Het
Cemip T G 7: 83,973,306 Y555S probably damaging Het
Cic T C 7: 25,271,600 V252A possibly damaging Het
Cracr2a A T 6: 127,611,507 N210Y probably damaging Het
Crocc2 G A 1: 93,202,856 R953Q possibly damaging Het
Csnk1d A G 11: 120,969,128 S318P probably benign Het
Ddx21 A G 10: 62,591,972 L384P probably damaging Het
Dnah5 C T 15: 28,270,474 T974I probably benign Het
Duox1 A G 2: 122,333,441 Y863C possibly damaging Het
Epg5 C A 18: 78,023,283 P2133T possibly damaging Het
Ephb6 A T 6: 41,614,185 Q92L possibly damaging Het
Ercc4 C A 16: 13,122,095 A73D probably damaging Het
Eva1c A T 16: 90,904,347 Y290F probably damaging Het
Galnt5 T A 2: 58,028,144 V798E possibly damaging Het
Haus4 T C 14: 54,548,885 E149G probably damaging Het
Ighv1-13 A G 12: 114,630,936 Y86C unknown Het
Igkv9-120 G T 6: 68,050,367 R88S possibly damaging Het
Lama3 T C 18: 12,500,563 V1584A probably benign Het
Lamb1 A G 12: 31,308,011 E1119G probably damaging Het
Lao1 T C 4: 118,967,988 L335P probably damaging Het
Mindy4 A G 6: 55,260,565 D375G probably damaging Het
Myo5a T C 9: 75,144,076 I317T probably damaging Het
Nlrp2 C T 7: 5,328,024 D458N probably damaging Het
Olfr107 T A 17: 37,406,200 C217* probably null Het
Olfr1497 A T 19: 13,795,045 C189S probably damaging Het
Olfr347 A T 2: 36,734,323 M1L probably benign Het
Olfr76 G T 19: 12,119,936 H247N probably damaging Het
Olfr938 T C 9: 39,078,692 T18A possibly damaging Het
Parp8 T C 13: 116,868,536 H663R probably damaging Het
Pax6 T C 2: 105,695,360 S377P probably benign Het
Pi15 A G 1: 17,602,766 D63G probably benign Het
Plaa A G 4: 94,586,258 probably benign Het
Rbm5 C A 9: 107,745,213 W546C probably damaging Het
Rnf123 C A 9: 108,052,089 C1257F probably damaging Het
Rnf185 A G 11: 3,432,551 S45P possibly damaging Het
Sh3bp1 T C 15: 78,904,497 S241P possibly damaging Het
Slfn8 G A 11: 83,003,197 A872V possibly damaging Het
Smoc1 G A 12: 81,104,773 probably null Het
Sox14 A T 9: 99,875,633 W18R probably damaging Het
Spata31d1a T C 13: 59,701,155 E1053G probably benign Het
Syne1 T A 10: 5,344,866 K1246* probably null Het
Tbrg4 A C 11: 6,620,909 S188A probably benign Het
Thnsl2 A T 6: 71,134,295 D196E probably damaging Het
Tmem266 C T 9: 55,380,741 T34I probably damaging Het
Tmem59l C A 8: 70,486,098 R111L probably benign Het
Tpr T C 1: 150,430,529 probably benign Het
Trpc6 T C 9: 8,643,686 S491P probably damaging Het
Tspan10 A T 11: 120,446,166 N254I probably damaging Het
Ubox5 A T 2: 130,591,894 L511Q probably damaging Het
Vmn1r183 TATCCATC TATC 7: 24,055,106 probably null Het
Vmn2r4 C T 3: 64,390,976 C577Y probably damaging Het
Vmn2r86 A T 10: 130,455,737 M53K probably benign Het
Zfp948 T A 17: 21,588,307 I587N possibly damaging Het
Other mutations in Nhlrc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01307:Nhlrc2 APN 19 56551799 nonsense probably null
IGL01524:Nhlrc2 APN 19 56576155 missense probably benign 0.39
IGL01570:Nhlrc2 APN 19 56574787 missense possibly damaging 0.87
IGL01653:Nhlrc2 APN 19 56570850 missense probably benign 0.25
IGL02256:Nhlrc2 APN 19 56597361 missense probably benign 0.10
IGL02303:Nhlrc2 APN 19 56574848 missense probably damaging 1.00
IGL02349:Nhlrc2 APN 19 56591719 missense possibly damaging 0.94
IGL02501:Nhlrc2 APN 19 56570654 nonsense probably null
R0270:Nhlrc2 UTSW 19 56551870 missense probably damaging 1.00
R0454:Nhlrc2 UTSW 19 56570527 missense probably damaging 1.00
R2022:Nhlrc2 UTSW 19 56597278 missense probably benign 0.06
R3854:Nhlrc2 UTSW 19 56588271 critical splice donor site probably null
R3855:Nhlrc2 UTSW 19 56588271 critical splice donor site probably null
R3856:Nhlrc2 UTSW 19 56588271 critical splice donor site probably null
R4659:Nhlrc2 UTSW 19 56576267 missense possibly damaging 0.86
R4992:Nhlrc2 UTSW 19 56570534 missense probably benign 0.00
R5877:Nhlrc2 UTSW 19 56570584 missense probably damaging 1.00
R6191:Nhlrc2 UTSW 19 56570859 missense probably benign 0.00
R6755:Nhlrc2 UTSW 19 56591784 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- CCATGAATGTGATCCTGTGTTTATG -3'
(R):5'- CTGTGTCCCTCTCCAATCAAAG -3'

Sequencing Primer
(F):5'- AGCGAGCTCTAGTGTATGG -3'
(R):5'- TGTGTCCCTCTCCAATCAAAGAAAAC -3'
Posted On2015-12-21