Incidental Mutation 'R4768:Olfr922'
ID366280
Institutional Source Beutler Lab
Gene Symbol Olfr922
Ensembl Gene ENSMUSG00000043911
Gene Nameolfactory receptor 922
SynonymsGA_x6K02T2PVTD-32518237-32519172, MOR161-3
MMRRC Submission 042409-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R4768 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location38814614-38819195 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38815949 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 149 (Y149N)
Ref Sequence ENSEMBL: ENSMUSP00000149057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051004] [ENSMUST00000213164]
Predicted Effect probably damaging
Transcript: ENSMUST00000051004
AA Change: Y149N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000057086
Gene: ENSMUSG00000043911
AA Change: Y149N

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 9.3e-52 PFAM
Pfam:7tm_1 41 290 3.4e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213164
AA Change: Y149N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933408B17Rik T C 18: 34,580,952 R207G probably damaging Het
Acadm A G 3: 153,922,942 Y419H probably benign Het
Adam28 A G 14: 68,634,815 V326A possibly damaging Het
Amdhd1 T A 10: 93,534,484 E164V possibly damaging Het
Arhgap5 T C 12: 52,557,492 L29S probably damaging Het
Asb5 G A 8: 54,584,996 D185N probably benign Het
Ascc3 T C 10: 50,700,499 I850T probably damaging Het
Atxn1 A G 13: 45,557,548 V636A probably damaging Het
Bmp4 C T 14: 46,385,924 R55Q probably damaging Het
Cmas T C 6: 142,764,431 probably null Het
Dchs1 T C 7: 105,771,620 D531G possibly damaging Het
Etv1 T C 12: 38,827,793 L44P probably damaging Het
Fam13c T A 10: 70,551,750 I448N probably damaging Het
Fuk T C 8: 110,892,134 T331A probably benign Het
Fut8 A G 12: 77,365,280 K135E probably benign Het
Gabrg1 A G 5: 70,754,173 F370S probably damaging Het
Ighv1-5 A T 12: 114,513,523 M53K probably damaging Het
Igkv9-120 G T 6: 68,050,367 R88S possibly damaging Het
Kansl1l A G 1: 66,801,133 V336A probably damaging Het
Krt27 T A 11: 99,349,525 D189V probably damaging Het
Marf1 A T 16: 14,131,597 F1033I possibly damaging Het
Mdfi G A 17: 47,824,550 T85M probably damaging Het
Mrgpra3 C A 7: 47,589,728 R150L possibly damaging Het
Mst1r C A 9: 107,911,650 T456K probably damaging Het
Myh14 A T 7: 44,613,675 M1734K probably benign Het
Myo1e T C 9: 70,370,469 I816T possibly damaging Het
Olfr1066 A T 2: 86,455,650 L207* probably null Het
Olfr77 A C 9: 19,920,545 N112T possibly damaging Het
Olfr874 T C 9: 37,746,881 L249P probably damaging Het
Pde4d A G 13: 109,933,874 R6G probably damaging Het
Pilrb1 G A 5: 137,857,526 probably benign Het
Prrx1 A G 1: 163,257,765 Y199H probably damaging Het
Rxfp1 T C 3: 79,686,868 D73G probably damaging Het
Ryr1 G T 7: 29,004,821 probably benign Het
Shprh A G 10: 11,181,540 E1068G probably damaging Het
Slc19a3 G A 1: 83,023,113 T61I probably damaging Het
Slc9a2 G A 1: 40,726,374 R308Q probably damaging Het
Suclg2 T G 6: 95,566,488 I321L probably damaging Het
Top3a A G 11: 60,762,490 F53L probably damaging Het
Ttn C T 2: 76,768,766 probably benign Het
Upp2 T C 2: 58,777,895 V182A probably damaging Het
Vmn2r65 A G 7: 84,947,394 L151P probably damaging Het
Xylt2 T C 11: 94,670,472 D155G probably benign Het
Zzz3 A G 3: 152,448,783 D557G probably damaging Het
Other mutations in Olfr922
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01631:Olfr922 APN 9 38816039 missense probably damaging 0.99
IGL02445:Olfr922 APN 9 38815605 missense possibly damaging 0.57
R1758:Olfr922 UTSW 9 38815575 missense probably benign
R1759:Olfr922 UTSW 9 38815898 missense probably damaging 1.00
R1809:Olfr922 UTSW 9 38816147 missense probably benign
R1938:Olfr922 UTSW 9 38815850 missense probably benign 0.33
R2177:Olfr922 UTSW 9 38816186 missense possibly damaging 0.82
R3438:Olfr922 UTSW 9 38816216 missense probably damaging 0.99
R3815:Olfr922 UTSW 9 38816426 missense possibly damaging 0.47
R3816:Olfr922 UTSW 9 38816426 missense possibly damaging 0.47
R3817:Olfr922 UTSW 9 38816426 missense possibly damaging 0.47
R3819:Olfr922 UTSW 9 38816426 missense possibly damaging 0.47
R3859:Olfr922 UTSW 9 38816147 missense probably benign
R5082:Olfr922 UTSW 9 38816145 missense possibly damaging 0.70
R5659:Olfr922 UTSW 9 38815776 missense probably benign 0.01
R5813:Olfr922 UTSW 9 38815656 missense probably benign 0.00
R6226:Olfr922 UTSW 9 38816370 missense probably damaging 0.99
R7240:Olfr922 UTSW 9 38815713 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTTTCTGAGAGGAACACAATTTCC -3'
(R):5'- ATCTGCCTTCAGTGGATCGG -3'

Sequencing Primer
(F):5'- CTATGAAGGATGCATGACTCAGCTC -3'
(R):5'- TGATGCTGGGCACACCTACATC -3'
Posted On2015-12-21